Previous Contig 008923:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015H24Sequence586005817 (6)640008923 (7)pir|T47690|T476903e-23hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi
JMFF017I22Sequence584005817 (6)773008923 (7)pir|T47690|T476905e-41hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi
JMFF028E17Sequence502005817 (6)751008923 (7)pir|T47690|T476908e-36hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi
JMFF028I04Sequence714008923 (7)pir|T47690|T476907e-36hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi
JMFN004L02Sequence621008923 (7)pir|T47690|T476909e-39hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi
JMSF019F19Sequence244005817 (6)702008923 (7)pir|T47690|T476901e-37hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi
JMSF023G13Sequence590005817 (6)781008923 (7)pir|T47690|T476905e-53hypothetical protein T22E16.170 - Arabidopsis thaliana>gb:ATT22E16_1555255 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023G13+ AGTGCNTTCAGTGGCTTAACAGTCTCTCTATTTCTAGTGGAACTTTTGTCCCTGTT
                      ____________________________________________________________
consensus AGTGCNTTCAGTGGCTTAACAGTCTCTCTATTTCTAGTGGAACTTTTGTCCCTGTT
 
. : . : . : . : . : . :
rJMSF023G13+ GCCTCGTTTGTGTTGGATGTTTTGGAATATAAAATAGTCAAAGAGGGTGGAAAACCTGGA
                      ____________________________________________________________
consensus GCCTCGTTTGTGTTGGATGTTTTGGAATATAAAATAGTCAAAGAGGGTGGAAAACCTGGA
 
. : . : . : . : . : . :
rJMSF023G13+ AATGCTGTTAACTTCAATTCTGTTTTGAAGTTACCAAAGCATTGCTTGAAGTCACGAACC
rJMFF028E17+ GAAGTTACCAAAGCATTGCTTGAAGTCACGACCC
rJMSF019F19+ TGAAGTCACGAACC
JMFN004L02- CAAAGCATTGCTTGAAGTCACGAACC
rJMFF017I22+ GCTGTTAACTTCAATTCTGTTTTGAAGTTACCAAAGCATTGCTTGAAGTCACGAACC
                      ____________________________________________________________
consensus AATGCTGTTAACTTCAATTCTGTTTTGAAGTTACCAAAGCATTGCTTGAAGTCACGAACC
 
. : . : . : . : . : . :
rJMSF023G13+ TT-CCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
rJMFF028E17+ TTCCCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
rJMFF028I04+ CCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
rJMSF019F19+ TT-CCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
JMFN004L02- TT-CCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
rJMFF017I22+ TT-CCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
                      ____________________________________________________________
consensus TT-CCAAGAGGAATGCGTTTTCTCAGCAATTGAACAACTATCAGCACATTTTGCTCAGTG
 
. : . : . : . : . : . :
rJMSF023G13+ GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
rJMFF028E17+ GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
rJMFF028I04+ GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
rJMSF019F19+ GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
JMFN004L02- GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
rJMFF017I22+ GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
rJMFF015H24+ GACTTAGCAACTATCCCAATCATTCGTTTAAAGAAATT
                      ____________________________________________________________
consensus GAGCTACCACATTTCCTTTCCCGACTTAGCAACTATCCCAATCATTCGTCTAAAGAAATT
 
. : . : . : . : . : . :
rJMSF023G13+ CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCNTTAATCGCTTGATTGACCAGGT
rJMFF028E17+ CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
rJMFF028I04+ CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
rJMSF019F19+ CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
JMFN004L02- CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
rJMFF017I22+ CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
rJMFF015H24+ CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
                      ____________________________________________________________
consensus CTGTGAGATGACTAGTGCCGACAGTTCAAAGCGAGTCATTAATCGCTTGATTGACCAGGT
 
. : . : . : . : . : . :
rJMSF023G13+ TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
rJMFF028E17+ TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
rJMFF028I04+ TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
rJMSF019F19+ TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
JMFN004L02- TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
rJMFF017I22+ TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
rJMFF015H24+ TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
                      ____________________________________________________________
consensus TGAGCAAAATGTGGGGCTTGTTCAAAAGAAGAGAGATGAGGTGGCTTTTTCACCTAATGA
 
. : . : . : . : . : . :
rJMSF023G13+ TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
rJMFF028E17+ TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
rJMFF028I04+ TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
rJMSF019F19+ TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
JMFN004L02- TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
rJMFF017I22+ TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
rJMFF015H24+ TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
                      ____________________________________________________________
consensus TCATCAATCCGTTGAATTATTTCTTCAGCTTGAGAAGTCAAGTTTGAAAGCTCCATTCAC
 
. : . : . : . : . : . :
rJMSF023G13+ TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
rJMFF028E17+ TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
rJMFF028I04+ TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
rJMSF019F19+ TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
JMFN004L02- TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
rJMFF017I22+ TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
rJMFF015H24+ TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
                      ____________________________________________________________
consensus TCAATACTACAAAAGTGTTCATGATAATGCTGCTCTAAGGACTTTGCGGAAGAATGAAAA
 
. : . : . : . : . : . :
rJMSF023G13+ GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
rJMFF028E17+ GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
rJMFF028I04+ GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
rJMSF019F19+ GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
JMFN004L02- GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
rJMFF017I22+ GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
rJMFF015H24+ GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
                      ____________________________________________________________
consensus GATGAGCTTGCCAACACCAAAGAAACCAAAGCGGAAAAGAGGGCAGCTCCGTGATGGCGT
 
. : . : . : . : . : . :
rJMSF023G13+ AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
rJMFF028E17+ AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
rJMFF028I04+ AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
rJMSF019F19+ AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
JMFN004L02- AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
rJMFF017I22+ AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
rJMFF015H24+ AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
                      ____________________________________________________________
consensus AGATGCTGATAAAGAAAGACACAACCCCAAAAATGATGATGCTATGGTTAACTTAAAGGG
 
. : . : . : . : . : . :
rJMSF023G13+ GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
rJMFF028E17+ GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
rJMFF028I04+ GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
rJMSF019F19+ GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
JMFN004L02- GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
rJMFF017I22+ GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
rJMFF015H24+ GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
                      ____________________________________________________________
consensus GAAGAAACAAAGAACTGTCAAAGCATAATTGTAACATCATTCTTCTTCACTACAAAATTT
 
. : . : . : . : . : . :
rJMSF023G13+ TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGGCCACT
rJMFF028E17+ TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-CACT
rJMFF028I04+ TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-CACT
rJMSF019F19+ TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-CACT
JMFN004L02- TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-C
rJMFF017I22+ TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-CACT
rJMFF015H24+ TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-CACT
                      ____________________________________________________________
consensus TGGGCTTTTAATTCTTAGCTTTGGATTGTAAGTGATGATTAGTCAAGGAAAGGGG-CACT
 
. : . : . : . : . : . :
rJMSF023G13+ GTGCCC
rJMFF028E17+ GTGCCCTACATGCTCTAACTACCTCAGACTTTATATTTCCCAGTTCATAGTAGAAGGATA
rJMFF028I04+ GTGCCCTACATGCTCTAACTACCTCAGACTTTATATTTCCCAGTTCATAGTAGAAGGATA
rJMSF019F19+ GTGCCCTACATGCTCTAACTACCTCAGACTTTATATTTCCCAGTTCATAGTAGAAGGATA
rJMFF017I22+ GTGCCCTACATGCTCTAACTACCTCAGACTTTATATTTCCCAGTTCATAGTAGAAGGATA
rJMFF015H24+ GTGCCCTACATGCTCTAACTACCTCAGACTTTATATTTCCCAGTTCATAGTAGAAGGATA
                      ____________________________________________________________
consensus GTGCCCTACATGCTCTAACTACCTCAGACTTTATATTTCCCAGTTCATAGTAGAAGGATA
 
. : . : . : . : . : . :
rJMFF028E17+ TGATCAAGACAAACAATTGGTTACTCAATTTTTGGCAACATTTATGATACGAAAAAAT
rJMFF028I04+ TGATCAAGACAAACAATTGGTTACTCAATTTTTGGCAACATTTATGATACGAAAAAAT
rJMSF019F19+ TGATCAAGACAAACAATTGGTTACTCAATT
rJMFF017I22+ TGATCAAGACAAACAATTGGTTACTCAATTTTTGGCAACATTTATGATACGAAAAAAT
rJMFF015H24+ TGATCAAGACAAACAATTGGTTACTCAATTTTTGGCAACATTTATGATACGAAAAAATTC
                      ____________________________________________________________
consensus TGATCAAGACAAACAATTGGTTACTCAATTTTTGGCAACATTTATGATACGAAAAAATTC