Previous Contig 008919:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015F23Sequence500008919 (6)sp|P19177|H2A_PETCR8e-19Histone H2A.>pir|S11498|S11498 histone H2A - parsley>gb:PCHISH2A_1699236 Parsley606008919 (6)gb:AC108876_17386245e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete s
JMSF001G18Sequence429008919 (6)sp|P19177|H2A_PETCR6e-19Histone H2A.>pir|S11498|S11498 histone H2A - parsley>gb:PCHISH2A_1699236 Parsley711008919 (6)gb:AC108876_17386247e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete s
JMSF033C14Sequence521008919 (6)sp|P19177|H2A_PETCR9e-19Histone H2A.>pir|S11498|S11498 histone H2A - parsley>gb:PCHISH2A_1699236 Parsley723008919 (6)gb:AC108876_17386247e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001G18- GCTCAATCCTCCGCATTAAGCGCTCCAATCTTTTTATACCC
JMFF015F23- ATCGTGCTCAATCCTCCGCATTAAGCGCTCCAATCTTTTTATACCC
JMSF033C14- GATCGTGCTCAATCCTCCGCATTAAGCGCTCCAATCTTTTTATACCC
                      ____________________________________________________________
consensus GATCGTGCTCAATCCTCCGCATTAAGCGCTCCAATCTTTTTATACCC
 
. : . : . : . : . : . :
JMSF001G18- AAAGAGTTTAGCTTAATTTAGCTTATCATTCCATGGATGCTCCGGCGGCGAAGATAAAGA
JMFF015F23- AAAGAGTTTAGCTTAATTTAGCTTATCATTCCATGGATGCTCCGGCGGCGAAGATAAAGA
JMSF033C14- AAAGAGTTTAGCTTAATTTAGCTTATCATTCCATGGATGCTCCGGCGGCGAAGATAAAGA
                      ____________________________________________________________
consensus AAAGAGTTTAGCTTAATTTAGCTTATCATTCCATGGATGCTCCGGCGGCGAAGATAAAGA
 
. : . : . : . : . : . :
JMSF001G18- AGGGTGCCGGCGGCCGGAAAGGCGGCGGCCCGAAGAAGAAGCCGGTTACCCGCTCCGTCC
JMFF015F23- AGGGTGCCGGCGGCCGGAAAGGCGGCGGCCCGAAGAAGAAGCCGGTTACCCGCTCCGTCC
JMSF033C14- AGGGTGCCGGCGGCCGGAAAGGCGGCGGCCCGAAGAAGAAGCCGGTTACCCGCTCCGTCC
rJMSF033C14+ AAGAAGAAGCCGGTTACCCGCTCCGTCC
rJMSF001G18+ GTCC
                      ____________________________________________________________
consensus AGGGTGCCGGCGGCCGGAAAGGCGGCGGCCCGAAGAAGAAGCCGGTTACCCGCTCCGTCC
 
. : . : . : . : . : . :
JMSF001G18- GTGCCGGGCTTCAGTTCCCGGTGGGTAGGATCGGGCGTTACCTCAAGAAGGGCCGCTATG
JMFF015F23- GTGCCGGGCTTCAGTTCCCGGTGGGTAGGATCGGGCGTTACCTCAAGAAGGGCCGCTATG
JMSF033C14- GTGCCGGGCTTCAGTTCCCGGTGGGTAGGATCGGGCGTTACCTCAAGAAGGGCCGCTATG
rJMSF033C14+ GTGCCGGGCTTCAGTTCCCGGTGGGTAGGATCGGGCGTTACCTCAAGAAGGGCCGCTATG
rJMSF001G18+ GTGCCGGGCTTCAGTTCCCGGTGGGTAGGATCGGGCGTTACCTCAAGAAGGGCCGCTATG
                      ____________________________________________________________
consensus GTGCCGGGCTTCAGTTCCCGGTGGGTAGGATCGGGCGTTACCTCAAGAAGGGCCGCTATG
 
. : . : . : . : . : . :
JMSF001G18- CCCAGCGTGTCGGCACCGGCGCTCCTGTTTACATGGCTGCCGTTCTCGAATACCTGGCTG
JMFF015F23- CCCAGCGTGTCGGCACCGGCGCTCCTGTTTACATGGCTGCCGTTCTCGAATACCTGGCTG
JMSF033C14- CCCAGCGTGTCGGCACCGGCGCTCCTGTTTACATGGCTGCCGTTCTCGAATACCTGGCTG
rJMSF033C14+ CCCAGCGTGTCGGCACCGGCGCTCCTGTTTACATGGCTGCCGTTCTCGAATACCTGGCTG
rJMSF001G18+ CCCAGCGTGTCGGCACCGGCGCTCCTGTTTACATGGCTGCCGTTCTCGAATACCTGGCTG
rJMFF015F23+ TGGCTG
                      ____________________________________________________________
consensus CCCAGCGTGTCGGCACCGGCGCTCCTGTTTACATGGCTGCCGTTCTCGAATACCTGGCTG
 
. : . : . : . : . : . :
JMSF001G18- CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
JMFF015F23- CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
JMSF033C14- CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
rJMSF033C14+ CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
rJMSF001G18+ CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
rJMFF015F23+ CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
                      ____________________________________________________________
consensus CCGAGGTATGTAGTGATTTATGTGTGTCTGTTTGTTTTACACTACTGGAAATTGTGAAAT
 
. : . : . : . : . : . :
JMSF001G18- TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
JMFF015F23- TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
JMSF033C14- TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
rJMSF033C14+ TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
rJMSF001G18+ TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
rJMFF015F23+ TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
                      ____________________________________________________________
consensus TTTCGATCACTTGAAAGTAAAAAGTGGTCGAAAATAATTTTTTTAGATATCAAAAGTGAT
 
. : . : . : . : . : . :
JMSF001G18- TGGAACAAGATTTTCGATTTGATTT
JMFF015F23- TGGAACAAGATTTTCGATTTGATTTAAGATAACTTTTANGTAGTCTGAAATTTCATAATT
JMSF033C14- TGGAACAAGATTTTCGATTTGATTTAAGATAACTTTTAGGTAGTCTGAAATTTCATAATT
rJMSF033C14+ TGGAACAAGATTTTCGATTTGATTTAAGATAACTTTTAGGTAGTCTGAAATTTCATAATT
rJMSF001G18+ TGGAACAAGATTTTCGATTTGATTTAAGATAACTTTTAGGTAGTCTGAAATTTCATAATT
rJMFF015F23+ TGGAACAAGATTTTCGATTTGATTTAAGATAACTTTTAGGTAGTCTGAAATTTCATAATT
                      ____________________________________________________________
consensus TGGAACAAGATTTTCGATTTGATTTAAGATAACTTTTAGGTAGTCTGAAATTTCATAATT
 
. : . : . : . : . : . :
JMFF015F23- ACCAGTAGTGTCAGATTTATGTTTGTGATTTACG
JMSF033C14- ACCAGTAGTGTCAGATTTATGTTTGTGATTTACGAGGTGGGGTTTTGGT
rJMSF033C14+ ACCAGTAGTGTCAGATTTATGTTTGTGATTTACGAGGTGGGGTTTTGGTTGGTTATAGGT
rJMSF001G18+ ACCAGTAGTGTCAGATTTATGTTTGTGATTTACGAGGTGGGGTTTTGGTTGGTTATAGGT
rJMFF015F23+ ACCAGTAGTGTCAGATTTATGTTTGTGATTTACGAGGTGGGGTTTTGGTTGGTTATAGGT
                      ____________________________________________________________
consensus ACCAGTAGTGTCAGATTTATGTTTGTGATTTACGAGGTGGGGTTTTGGTTGGTTATAGGT
 
. : . : . : . : . : . :
rJMSF033C14+ TTTGGAGTTGGCTGGAAATGCAGCGAGGGACAACAAGAAGAACAGGATCATTCCCAGACA
rJMSF001G18+ TTTGGAGTTGGCTGGAAATGCAGCGAGGGACAACAAGAAGAACAGGATCATTCCCAGACA
rJMFF015F23+ TTTGGAGTTGGCTGGAAATGCAGCGAGGGACAACAAGAAGAACAGGATCATTCCCAGACA
                      ____________________________________________________________
consensus TTTGGAGTTGGCTGGAAATGCAGCGAGGGACAACAAGAAGAACAGGATCATTCCCAGACA
 
. : . : . : . : . : . :
rJMSF033C14+ TGTTCTTTTGGCTGTGAGGAACGATGAGGAGCTGGGGAAGTTGTTGGCTGGGGTGACCAT
rJMSF001G18+ TGTTCTTTTGGCTGTGAGGAACGATGAGGAGCTGGGGAAGTTGTTGGCTGGGGTGACCAT
rJMFF015F23+ TGTTCTTTTGGCTGTGAGGAACGATGAGGAGCTGGGGAAGTTGTTGGCTGGGGTGACCAT
                      ____________________________________________________________
consensus TGTTCTTTTGGCTGTGAGGAACGATGAGGAGCTGGGGAAGTTGTTGGCTGGGGTGACCAT
 
. : . : . : . : . : . :
rJMSF033C14+ TGCCCATGGTGGGGTGCTGCCCAACATAAACCCTGTGTTGTTGCCCAAGAAGAGTGGATC
rJMSF001G18+ TGCCCATGGTGGGGTGCTGCCCAACATAAACCCTGTGTTGTTGCCCAAGAAGAGTGGATC
rJMFF015F23+ TGCCCATGGTGGGGTGCTGCCCAACATAAACCCTGTGTTGTTGCCCAAGAAGAGTGGATC
                      ____________________________________________________________
consensus TGCCCATGGTGGGGTGCTGCCCAACATAAACCCTGTGTTGTTGCCCAAGAAGAGTGGATC
 
. : . : . : . : . : . :
rJMSF033C14+ TGAGGCAACAAAGGAGCCAAAGGCAAAGGCTGCCAAGTCCCCCAAGAAGAAGGCTGCTTG
rJMSF001G18+ TGAGGCAACAAAGGAGCCAAAGGCAAAGGCTGCCAAGTCCCCCAAGAAGAAGGCTGCTTG
rJMFF015F23+ TGAGGCAACAAAGGAGCCAAAGGCAAAGGCTGCCAAGTCCCCCAAGAAGAAGGCTGCTTG
                      ____________________________________________________________
consensus TGAGGCAACAAAGGAGCCAAAGGCAAAGGCTGCCAAGTCCCCCAAGAAGAAGGCTGCTTG
 
. : . : . : . : . : . :
rJMSF033C14+ ATTTGATAGTGTAGATTAGTGGGGTTTTGTCCCTTGTTTCTGTATGTGACTTGGGGCCAT
rJMSF001G18+ ATTTGATAGTGTAGATTAGTGGGGTTTTGTCCCTTGTTTCTGTATGTGACTTGGGGCCAT
rJMFF015F23+ ATTTGATAGTGTAGATTAGTGGGGTTTTGTCCCTTGTTTCTGTATGTGACTTGGGGCCAT
                      ____________________________________________________________
consensus ATTTGATAGTGTAGATTAGTGGGGTTTTGTCCCTTGTTTCTGTATGTGACTTGGGGCCAT
 
. : . : . : . : . : . :
rJMSF033C14+ TCTTTGCTTATAGAAGGTGTAATTGTTAGTTGTGT
rJMSF001G18+ TCTTTGCTTATAGAAGGTGTAATTGTTAGTTGTGTTGTAAAC
rJMFF015F23+ TCTTTGCTTATAGAAGGTGTAATTGTTAGTTGTGTTGTAAACGTAATGTTTGGTTATCAA
                      ____________________________________________________________
consensus TCTTTGCTTATAGAAGGTGTAATTGTTAGTTGTGTTGTAAACGTAATGTTTGGTTATCAA