Previous Contig 008913:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015E02Sequence582014358gb:AF092743_17675653e-58Populus tremula x Populus tremuloides CAK associated cyclinH homolog (cycH) mRNA648008913 (3)
JMSF045H10Sequence775008913 (3)gb:AB051072_15210673e-23Arabidopsis thaliana AtCycH1 mRNA for cyclin H, complete cds.>gb:AK118707_181667917008913 (3)gb:AB051072_15210671e-24Arabidopsis thaliana AtCycH1 mRNA for cyclin H, complete cds.>gb:AK118707_181667

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045H10- GAGATTTCAGGTACATCCTTCT
                      ____________________________________________________________
consensus GAGATTTCAGGTACATCCTTCT
 
. : . : . : . : . : . :
JMSF045H10- ATAGCTAGGGTTTTTACATTTCACCGATAAAACCCTTGACTTCACCTGCAAATTCCTCAT
                      ____________________________________________________________
consensus ATAGCTAGGGTTTTTACATTTCACCGATAAAACCCTTGACTTCACCTGCAAATTCCTCAT
 
. : . : . : . : . : . :
JMSF045H10- TTTTGAAGGAAGTTTCTGATTTTAATTCTATGAATTTTCTTAGTTTTTTGGAATAGAACA
                      ____________________________________________________________
consensus TTTTGAAGGAAGTTTCTGATTTTAATTCTATGAATTTTCTTAGTTTTTTGGAATAGAACA
 
. : . : . : . : . : . :
JMSF045H10- AATTAAGTTCGAAATTGGATATTGCCGTGGATATCACACATCGTTTTGGTGGTGATCACG
                      ____________________________________________________________
consensus AATTAAGTTCGAAATTGGATATTGCCGTGGATATCACACATCGTTTTGGTGGTGATCACG
 
. : . : . : . : . : . :
JMSF045H10- GTGGAAATTGGTGGCGGTCATGGCGGTTTAACGGAGCAGACAACAATGGCGGATTTCACC
                      ____________________________________________________________
consensus GTGGAAATTGGTGGCGGTCATGGCGGTTTAACGGAGCAGACAACAATGGCGGATTTCACC
 
. : . : . : . : . : . :
JMSF045H10- ACCTCAACTCACCGAGCCAAGTGGATTTTCTCTCCCCAAGATCTCAAGGAAAAGTTTAAG
                      ____________________________________________________________
consensus ACCTCAACTCACCGAGCCAAGTGGATTTTCTCTCCCCAAGATCTCAAGGAAAAGTTTAAG
 
. : . : . : . : . : . :
JMSF045H10- GCTGTCAATCAGAGAGCTAAACAGGCATTGGAGAAGTATGGAACAACTCGAATGGAAGTA
                      ____________________________________________________________
consensus GCTGTCAATCAGAGAGCTAAACAGGCATTGGAGAAGTATGGAACAACTCGAATGGAAGTA
 
. : . : . : . : . : . :
JMSF045H10- GATGTTGATGGGTCTTTCTCATATGTGGAACCGCCAGCTGGTGCAAAAGAAACCGTTGAA
                      ____________________________________________________________
consensus GATGTTGATGGGTCTTTCTCATATGTGGAACCGCCAGCTGGTGCAAAAGAAACCGTTGAA
 
. : . : . : . : . : . :
JMSF045H10- GGTTTTGTCAATGATATAGAGGAGTTCCGTGGAGCTGAAGGTGAGCAACTTGATACACTG
rJMSF045H10+ CAATGATATAGAGGAGTTCCGTGGAGCTGAAGGTGAGCCACCTGATACACTG
                      ____________________________________________________________
consensus GGTTTTGTCAATGATATAGAGGAGTTCCGTGGAGCTGAAGGTGAGCCACTTGATACACTG
 
. : . : . : . : . : . :
JMSF045H10- AAGAAATTGCTTGAAAGTGCCAAGATAGAAGCAGATAGGACTATGCTTACAGATGCAACC
rJMSF045H10+ AAGAAATTGCNTGAAAGTGCCNAGATAGAAGCAGATAGGACTATGCTTACAGATGCAACC
                      ____________________________________________________________
consensus AAGAAATTGCTTGAAAGTGCCAAGATAGAAGCAGATAGGACTATGCTTACAGATGCAACC
 
. : . : . : . : . : . :
JMSF045H10- CTTTTATTTCCACCTGGGCAGTTGGCACTGACAGCGCTTCGTAGAGCTAATGAGAAGCTT
rJMSF045H10+ CTTTTATTTCCACCTGGGCAGTTGGCACTGACAGCGCTTCGTAGAGCTAATGAGAAGCTT
                      ____________________________________________________________
consensus CTTTTATTTCCACCTGGGCAGTTGGCACTGACAGCGCTTCGTAGAGCTAATGAGAAGCTT
 
. : . : . : . : . : . :
JMSF045H10- CGTGTTTTTGAGTTTGAGAGATACCTTGAAAGAATTTTAGCACGCCAACAACCTACTCAT
rJMSF045H10+ CGTGTTTTTGAGTTTGAGAGATACCTTGAAAGAATTTTAGCACGCCAACAACCTACTCAT
                      ____________________________________________________________
consensus CGTGTTTTTGAGTTTGAGAGATACCTTGAAAGAATTTTAGCACGCCAACAACCTACTCAT
 
. : . : . : . : . : . :
JMSF045H10- TCCATTTCAGACCTAAGTGGCCTTTTAAAACCTATTGAGTCTTTGATAAATAAACTTGAG
rJMSF045H10+ TCCATTTCAGACCTAAGTGGCCTTTTAAAACCTATTGAGTCTTTGATAAATAAACTTGAG
                      ____________________________________________________________
consensus TCCATTTCAGACCTAAGTGGCCTTTTAAAACCTATTGAGTCTTTGATAAATAAACTTGAG
 
. : . : . : . : . : . :
JMSF045H10- TCCCCTTCGGCCAAAGATGTGAAAGCACATTGA
rJMSF045H10+ TCCCCTTCGGCCAAAGATGTG-AAGCACATTGATCGGAAACTAAAATCGTGCCTGGATCC
                      ____________________________________________________________
consensus TCCCCTTCGGCCAAAGATGTGAAAGCACATTGATCGGAAACTAAAATCGTGCCTGGATCC
 
. : . : . : . : . : . :
rJMSF045H10+ TGGTCTACATGACAAAAGTAAGAAGAGGAAGCACAGATCAAAAGATAGTTCAAATGAAGT
rJMFF015E02+ GACAAAAGTAAGAAGAGGAAGCNCAGATCAAAAGATAGTTCAAATGAAGT
                      ____________________________________________________________
consensus TGGTCTACATGACAAAAGTAAGAAGAGGAAGCACAGATCAAAAGATAGTTCAAATGAAGT
 
. : . : . : . : . : . :
rJMSF045H10+ GCATGACATGGCTTGAGTTATTCATACGAAATTCATATTCTTGTGTGGAATGACTATTTG
rJMFF015E02+ GCATGACATGGCTTGAGTTATTCATACGAAATTCATATTCTTGTGTGGAATGACTATTTG
                      ____________________________________________________________
consensus GCATGACATGGCTTGAGTTATTCATACGAAATTCATATTCTTGTGTGGAATGACTATTTG
 
. : . : . : . : . : . :
rJMSF045H10+ TTGCTGCTCTTCATCAGTTAATTTACTAATTAGTCCTGAGATTCATGGTGTACGGAACAA
rJMFF015E02+ TTGCTGCTCTTCATCAGTTAATTTACTAATTAGTCCTGAGATTCATGGTGTACGGAACAA
                      ____________________________________________________________
consensus TTGCTGCTCTTCATCAGTTAATTTACTAATTAGTCCTGAGATTCATGGTGTACGGAACAA
 
. : . : . : . : . : . :
rJMSF045H10+ AGACCCGATTTTGGAACTTCCCAATTTCCTTTGCCCCCTTTTGTGGGTGAGTCAAGTAGA
rJMFF015E02+ AGACCCGATTTTGGAACTTCCCAATTTCCTTTGCCCCCTTTTGTGGGTGAGTCAAGTAGA
                      ____________________________________________________________
consensus AGACCCGATTTTGGAACTTCCCAATTTCCTTTGCCCCCTTTTGTGGGTGAGTCAAGTAGA
 
. : . : . : . : . : . :
rJMSF045H10+ CTATATATGTCATATAATTGGAGTCTATGCACACCTAAGTTGATGTTGCGATGAAGCACA
rJMFF015E02+ CTATATATGTCATATAATTGGAGTCTATGCACACCTAAGTTGATGTTGCGATGAAGCACA
                      ____________________________________________________________
consensus CTATATATGTCATATAATTGGAGTCTATGCACACCTAAGTTGATGTTGCGATGAAGCACA
 
. : . : . : . : . : . :
rJMSF045H10+ AATCCTTTCTCTTGTACTCAAGACAGTAGAGCGGCTGATTGCCGAGGAACAGGTTTCTAC
rJMFF015E02+ AATCCTTTCTCTTGTACTCAAGACAGTAGAGCGGCTGATTGCCGAGGAACAGGTTTCTAC
                      ____________________________________________________________
consensus AATCCTTTCTCTTGTACTCAAGACAGTAGAGCGGCTGATTGCCGAGGAACAGGTTTCTAC
 
. : . : . : . : . : . :
rJMSF045H10+ TCTGTGAAGATGCTCAATGCAGCCAGCTCAAAGAAGCGATCTTGATTGTGAAAGATCTCG
rJMFF015E02+ TCTGTGAAGATGCTCAATGCAGCCAGCTCAAAGAAGCGATCTTGATTGTGAAAGATCTCG
                      ____________________________________________________________
consensus TCTGTGAAGATGCTCAATGCAGCCAGCTCAAAGAAGCGATCTTGATTGTGAAAGATCTCG
 
. : . : . : . : . : . :
rJMSF045H10+ ATTTTGTTCTTCGCTGTGAATCGGAGGAATGCTGACCCATTCTTGAAAAAGAACTGCAAA
rJMFF015E02+ ATTTTGTTCTTCGCTGTGAATCGGAGGAATGCTGACCCATTCTTGAAAAAGAACTGCAAA
                      ____________________________________________________________
consensus ATTTTGTTCTTCGCTGTGAATCGGAGGAATGCTGACCCATTCTTGAAAAAGAACTGCAAA
 
. : . : . : . : . : . :
rJMSF045H10+ ACTGGATGTTATTGTTGGTTGTTCCTCGTTATTATGTTGTGTGATTTTAATTTGANCTGT
rJMFF015E02+ ACTGGATGTTATTGTTGGTTGTTCCTCGTTATTATGTTGTGTGATTTTAATTTGA-CTGT
                      ____________________________________________________________
consensus ACTGGATGTTATTGTTGGTTGTTCCTCGTTATTATGTTGTGTGATTTTAATTTGANCTGT
 
. : . : . : . : . : . :
rJMSF045H10+ GATAGTGAAGTACCAGTTTATCTGAT
rJMFF015E02+ GATAGTGAAGTA-CAGTTTATCTGATTGTAAACATTGACATATCTTTCTATATTTTCGGT
                      ____________________________________________________________
consensus GATAGTGAAGTACCAGTTTATCTGATTGTAAACATTGACATATCTTTCTATATTTTCGGT
 
. : . : . : . : . : . :
rJMFF015E02+ GCACACAATTCTTCATATGCATCAATTATAGTTATGTAACGAATGATTCTATGACAATAG
                      ____________________________________________________________
consensus GCACACAATTCTTCATATGCATCAATTATAGTTATGTAACGAATGATTCTATGACAATAG