Previous Contig 008911:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015D03Sequence584008911 (12)sp|Q43291|RL21_ARATH1e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A686008911 (12)sp|Q43291|RL21_ARATH2e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A
JMFF027D08Sequence535008911 (12)sp|Q43291|RL21_ARATH2e-7860S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A721008911 (12)sp|Q43291|RL21_ARATH2e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A
JMFF036C24Sequence495008911 (12)sp|Q43291|RL21_ARATH2e-7060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A683008911 (12)sp|Q43291|RL21_ARATH2e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A
JMSF017J08Sequence270008911 (12)pir|H96610|H966101e-33probable 60S ribosomal protein L21 [imported] - Arabidopsis thaliana>gb:AE005173653008911 (12)sp|Q43291|RL21_ARATH2e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A
JMSF052A09Sequence262008911 (12)gb:AE016959_10230015e-06Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02213008911 (12)gb:AE016959_10230015e-06Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF052H13Sequence632008911 (12)sp|Q43291|RL21_ARATH2e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A577008911 (12)sp|Q43291|RL21_ARATH1e-8060S ribosomal protein L21.>pir|G86230|G86230 hypothetical protein [imported] - A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052A09+ TTTTTTTTTTGATCTATAATTTGACACA
rJMFF027D08- TGATCTATAATTTGACACA
                      ____________________________________________________________
consensus TTTTTTTTTTGATCTATAATTTGACACA
 
. : . : . : . : . : . :
rJMSF052A09- ATGTTCAACTACAAATATAAAAGGCCAACACAAAAAAA
JMSF052A09+ AAGGCACATAAATTCAGCAAACATGTTCAACTACAAATATAAAAGGCCAACACAAAAAAA
rJMFF027D08- AAGGCACATAAATTCAGCAAACATGTTCAACTACAAATATAAAAGGCCAACACAAAAAAA
rJMSF017J08- AAAAAA
rJMFF036C24- ATGTTCAACTACAAATATAAAAGGCCAACACAAAAAAA
rJMFF015D03- AAATATAAAAGGCCAACACAAAAAAA
                      ____________________________________________________________
consensus AAGGCACATAAATTCAGCAAACATGTTCAACTACAAATATAAAAGGCCAACACAAAAAAA
 
. : . : . : . : . : . :
rJMSF052A09- TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
JMSF052A09+ TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
rJMFF027D08- TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
rJMSF017J08- TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
JMSF052H13+ TGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
JMFF015D03+ G
rJMFF036C24- TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
rJMFF015D03- TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
                      ____________________________________________________________
consensus TTCAAACAAAACCGAGTGTGTGGACATGAAAACAACATTAATTAGAACTCTGATTAACTG
 
. : . : . : . : . : . :
rJMSF052A09- TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
JMSF052A09+ TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
rJMFF027D08- TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
rJMSF017J08- TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
rJMSF052H13- AAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
JMSF052H13+ TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
JMFF015D03+ TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
rJMFF036C24- TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
JMFF027D08+ CCTTGAGATC
rJMFF015D03- TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
                      ____________________________________________________________
consensus TTCATAAAACGATAAAGACATCTCGAATAAACAAGGAATTTAGTATCCTCCCTTGAGATC
 
. : . : . : . : . : . :
rJMSF052A09- ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCC
JMSF052A09+ ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCC
rJMFF027D08- ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
rJMSF017J08- ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
rJMSF052H13- ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
JMSF052H13+ ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
JMFF015D03+ ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
rJMFF036C24- ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
JMFF027D08+ ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
JMFF036C24+ GGTTTCTAGAGTGGCACCTTCCACCATAAA
rJMFF015D03- ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
                      ____________________________________________________________
consensus ATTGACCACATCATATGGGATGGGTGTTACGGTTTCTAGAGTGGCACCTTCCACCATAAA
 
. : . : . : . : . : . :
rJMFF027D08- TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
rJMSF017J08- TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
rJMSF052H13- TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
JMSF052H13+ TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
JMFF015D03+ TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
rJMFF036C24- TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
JMFF027D08+ TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
JMFF036C24+ TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
rJMFF015D03- TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
                      ____________________________________________________________
consensus TCCAGGTTTGGGTCCTTTCGGCTGCCTCTTAGTACTAATCACCACACCTTTGGCTTTTGC
 
. : . : . : . : . : . :
rJMFF027D08- TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
rJMSF017J08- TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
rJMSF052H13- TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
JMSF052H13+ TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
JMFF015D03+ TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
rJMFF036C24- TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
JMFF027D08+ TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
JMFF036C24+ TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
rJMFF015D03- TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
                      ____________________________________________________________
consensus TTCAGCCTTGAGCTGATCATTTTTCTTTACCCTCTCCTTAAACTCTTCAGTGCACCTTGA
 
. : . : . : . : . : . :
rJMFF027D08- AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
rJMSF017J08- AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
rJMSF052H13- AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
JMSF052H13+ AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
JMFF015D03+ AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
rJMFF036C24- AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
JMFF027D08+ AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
JMFF036C24+ AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
rJMFF015D03- AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
                      ____________________________________________________________
consensus AAGTTGAACATGCTCAATACGAACATGGATTCTCTTCCTGATGATCCTGTTGCCAACCTG
 
. : . : . : . : . : . :
rJMFF027D08- CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
rJMSF017J08- CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
rJMSF052H13- CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
JMSF052H13+ CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
JMFF015D03+ CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
JMSF017J08+ CGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
rJMFF036C24- CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
JMFF027D08+ CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
JMFF036C24+ CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
rJMFF015D03- CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
                      ____________________________________________________________
consensus CTTGTTGACTTCGACACCAATGGCGCGCTTAGTGACGTTCCAGACGCGGCCGGTGCGACC
 
. : . : . : . : . : . :
rJMFF027D08- GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
rJMSF017J08- GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
rJMSF052H13- GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
JMSF052H13+ GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
JMFF015D03+ GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
JMSF017J08+ GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
rJMFF036C24- GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
JMFF027D08+ GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
JMFF036C24+ GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
rJMFF015D03- GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
                      ____________________________________________________________
consensus GTGATAGAACTTGTGAGGCATGCCCTTGTGGATGGCACCGTTCACCTTTACGTCAACGTA
 
. : . : . : . : . : . :
rJMFF027D08- GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
rJMSF017J08- GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
rJMSF052H13- GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
JMSF052H13+ GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
JMFF015D03+ GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
JMSF017J08+ GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
rJMFF036C24- GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
JMFF027D08+ GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
JMFF036C24+ GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
rJMFF015D03- GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
                      ____________________________________________________________
consensus GTCGCCGATGTGGAAGATACGCAAGTAGGTGGATAGCGGAATGGTCCCGCGCTTCCTGAA
 
. : . : . : . : . : . :
rJMFF027D08- CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
rJMSF017J08- CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
rJMSF052H13- CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
JMSF052H13+ CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
JMFF015D03+ CTCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
JMSF017J08+ CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
rJMFF036C24- CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
JMFF027D08+ CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
JMFF036C24+ CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
rJMFF015D03- CTCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
                      ____________________________________________________________
consensus CCCGCGAGAGAAGAGATCTCTCGTCCTCGCCCTTAATCCGTGTCCGGCAGGCATTTTGCT
 
. : . : . : . : . : . :
rJMFF027D08- TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTG
rJMSF017J08- TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGT
rJMSF052H13- TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTCGA
JMSF052H13+ TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTCGA
JMFF015D03+ TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTC
JMSF017J08+ TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGT
rJMFF036C24- TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTCGA
JMFF027D08+ TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTCGA
JMFF036C24+ TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTCGA
rJMFF015D03- TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGTGGGGTCAAGCGGTTCTCGACGAATT
                      ____________________________________________________________
consensus TTCTCTTCTTCTTCTTCTCCGACTGGGTAAAGTGT-GGGTCGAGCGGTTCTCGACGAATT