Previous Contig 008907:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015B15Sequence637008907 (4)gb:AY552546_16134004e-28Ipomoea batatas Kunitz-type trypsin inhibitor mRNA, complete cds.715008907 (4)gb:AP005406_18512211e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B114
JMSF013L22Sequence254008907 (4)gb:AY086023_15710847e-08Arabidopsis thaliana clone 207075 mRNA, complete sequence.>gb:AK118688_1816651 A726008907 (4)gb:AY086023_15710846e-33Arabidopsis thaliana clone 207075 mRNA, complete sequence.>gb:AK118688_1816651 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015B15- ACTCACCACCACACAGTTAAAATA
                      ____________________________________________________________
consensus ACTCACCACCACACAGTTAAAATA
 
. : . : . : . : . : . :
JMFF015B15- CGTAAAGCTTCCCAAAAAACACTCCATCTTCTTCATCCTCGATGGCTTCATCTCTCCGTT
                      ____________________________________________________________
consensus CGTAAAGCTTCCCAAAAAACACTCCATCTTCTTCATCCTCGATGGCTTCATCTCTCCGTT
 
. : . : . : . : . : . :
JMFF015B15- CATTTGCAGCTGCCCTTCTCTTTGTGATGCTGTTCATGGCCACTGAGCTGGGAACAAACA
                      ____________________________________________________________
consensus CATTTGCAGCTGCCCTTCTCTTTGTGATGCTGTTCATGGCCACTGAGCTGGGAACAAACA
 
. : . : . : . : . : . :
JMFF015B15- CAATAATGGTGGCGGAGGCGAGGATGTGCGAGTCGCCGAGCTCGAAGTTCAAGGGGCCAT
                      ____________________________________________________________
consensus CAATAATGGTGGCGGAGGCGAGGATGTGCGAGTCGCCGAGCTCGAAGTTCAAGGGGCCAT
 
. : . : . : . : . : . :
JMFF015B15- GTGCTCGGGACAGCAACTGCGCAACGGTTTGCCACACGGAGGGGTTCTCCGGCGGCGACT
                      ____________________________________________________________
consensus GTGCTCGGGACAGCAACTGCGCAACGGTTTGCCACACGGAGGGGTTCTCCGGCGGCGACT
 
. : . : . : . : . : . :
JMFF015B15- GCAAAGGGTTGCGCCGCCGCTGCTTCTGCACTAAGCCTTGCTAATTCATCATCTATCCAT
                      ____________________________________________________________
consensus GCAAAGGGTTGCGCCGCCGCTGCTTCTGCACTAAGCCTTGCTAATTCATCATCTATCCAT
 
. : . : . : . : . : . :
JMFF015B15- ATAGGCAGCAGCTGCAAATTTCAATTTTCCCTCTTTCCCCTTCCCCTTTCCCTTCTTAAC
                      ____________________________________________________________
consensus ATAGGCAGCAGCTGCAAATTTCAATTTTCCCTCTTTCCCCTTCCCCTTTCCCTTCTTAAC
 
. : . : . : . : . : . :
JMFF015B15- CCACTAAAACCCTCCCTCTCCAACATCTCGTCATTTCTGCATATTGGATTGCTAAGTTAA
JMSF013L22- GTCATTTCTGCATATTGGATTGCTAAGTTAA
                      ____________________________________________________________
consensus CCACTAAAACCCTCCCTCTCCAACATCTCGTCATTTCTGCATATTGGATTGCTAAGTTAA
 
. : . : . : . : . : . :
JMFF015B15- TTGAGTATCTGCGGCTGCTACTACTACTACTAGTGTCGTCGTAGAATGGCTGGTGGCGGA
JMSF013L22- TTGAGTATCTGCGGCTGCTACTACTACTACTAGTGTCGTCGTAGAATGGCTGGTGGCGGA
                      ____________________________________________________________
consensus TTGAGTATCTGCGGCTGCTACTACTACTACTAGTGTCGTCGTAGAATGGCTGGTGGCGGA
 
. : . : . : . : . : . :
JMFF015B15- GCATCCGGTAAGTCTTCGAACGCACCCAGAGTGAGGAAGAAGGGTGGAGGTTGATTCCAA
JMSF013L22- GCATCCGGTAAGTCTTCGAACGCACCCAGAGTGAGGAAG-AGGGTGGAGGTTGATTCCAA
rJMSF013L22+ TTCGAACGCCCCCAGAGTGAGGAAG-AGGGTGGAGGTTGATTCCAA
                      ____________________________________________________________
consensus GCATCCGGTAAGTCTTCGAACGCACCCAGAGTGAGGAAG-AGGGTGGAGGTTGATTCCAA
 
. : . : . : . : . : . :
JMFF015B15- TGAATCCTCGCAGATAAACGCCAGCCTCAAGCGCGCCAAGGACGGCAGTGCTTTCGCTCG
JMSF013L22- TGAATCCTCGCAGATAAACGCCAGCCTCAAGCGCGCCAAGGACGGCAGTGCTTTCGCTCG
rJMSF013L22+ TGAATCCTCGCAGATAAACGCCAGCCTCAAGCGCGCCAAGGACGGCAGTGCTTTCGCTCG
rJMFF015B15+ TCGCAGATAAACGCCAGCCTCAAGCGCGCCAAGGACGGCAGTGCTTTCGCTCG
                      ____________________________________________________________
consensus TGAATCCTCGCAGATAAACGCCAGCCTCAAGCGCGCCAAGGACGGCAGTGCTTTCGCTCG
 
. : . : . : . : . : . :
JMFF015B15- TTGTGATGAATGC
JMSF013L22- TTGTGATGAATGCANCAAAGATGTACCGGTGGCTTTGATTAGT
rJMSF013L22+ TTGTGATGAATGCAACAAAGATGTACCGGTGGCTTTGATTAGTTTTCACAATTGTAGCCT
rJMFF015B15+ TTGTGATGAATGCAACAAAGATGTACCGGTGGCTTTGATTAGTTTTCACAATTGTAGCCT
                      ____________________________________________________________
consensus TTGTGATGAATGCAACAAAGATGTACCGGTGGCTTTGATTAGTTTTCACAATTGTAGCCT
 
. : . : . : . : . : . :
rJMSF013L22+ AGATGCCAAGATCAAGATGAATTTGGAAGCACAGATTATAGAGAAGCCAGCTGAGCCCAA
rJMFF015B15+ AGATGCCAAGATCAAGATGAATTTGGAAGCACAGATTATAGAGAAGCCAGCTGAGCCCAA
                      ____________________________________________________________
consensus AGATGCCAAGATCAAGATGAATTTGGAAGCACAGATTATAGAGAAGCCAGCTGAGCCCAA
 
. : . : . : . : . : . :
rJMSF013L22+ GAAAAAGCCAACTGAAAAGAAAAAGGCAAGATCTACTGAACCAAAAGCCAAGAAGGAAAA
rJMFF015B15+ GAAAAAGCCAACTGAAAAGGAAAAGGCAAGATCTACTGAACCAAAAGCCAAGAAGGAAAA
                      ____________________________________________________________
consensus GAAAAAGCCAACTGAAAAGGAAAAGGCAAGATCTACTGAACCAAAAGCCAAGAAGGAAAA
 
. : . : . : . : . : . :
rJMSF013L22+ GAAGGCTAAGGATCCCAATGCACCAAAGCGCCCTCCCACTGCATTCTTTGTTTTCATGGA
rJMFF015B15+ GAAGGCTAAGGATCCCAATGCACCAAAGCGCCCTCCCACTGCATTCTTTGTTTTCATGGA
                      ____________________________________________________________
consensus GAAGGCTAAGGATCCCAATGCACCAAAGCGCCCTCCCACTGCATTCTTTGTTTTCATGGA
 
. : . : . : . : . : . :
rJMSF013L22+ AGAGTTTAGGAAGACTTTCAAGGAGGAAAATCCTGACATCAAGAGTGTTGCTACGGTTGC
rJMFF015B15+ AGAGTTTAGGAAGACTTTCAAGGAGGAAAATCCTGACATCAAGAGTGTTGCTACGGTTGC
                      ____________________________________________________________
consensus AGAGTTTAGGAAGACTTTCAAGGAGGAAAATCCTGACATCAAGAGTGTTGCTACGGTTGC
 
. : . : . : . : . : . :
rJMSF013L22+ TAAGGAGGGTGGTGAGAAGTGGAAGTCCCTAACAGATGAAGAGAAGAAGCTTTATATTGA
rJMFF015B15+ TAAGGAGGGTGGTGAGAAGTGGAAGTCCCTAACAGATGAAGAGAAGAAGCTTTATATTGA
                      ____________________________________________________________
consensus TAAGGAGGGTGGTGAGAAGTGGAAGTCCCTAACAGATGAAGAGAAGAAGCTTTATATTGA
 
. : . : . : . : . : . :
rJMSF013L22+ TAGGGCTGCAGAACGCAAGGCAGAATATGAGAAGGCTTTGGAATCCAATAATGCTACTGA
rJMFF015B15+ TAGGGCTGCAGAACGCAAGGCAGAATATGAGAAGGCTTTGGAATCCAATAATGCTACTGA
                      ____________________________________________________________
consensus TAGGGCTGCAGAACGCAAGGCAGAATATGAGAAGGCTTTGGAATCCAATAATGCTACTGA
 
. : . : . : . : . : . :
rJMSF013L22+ GAATGAAGATGATGGAGATGAGTCAGAGAAGGAAGTGAAGGAGGAGGTCCAGGAGGTGAA
rJMFF015B15+ GAATGAAGATGATGGAGATGAGTCAGAGAAGGAAGTGAAGGAGGAGGTCCAGGAGGTGAA
                      ____________________________________________________________
consensus GAATGAAGATGATGGAGATGAGTCAGAGAAGGAAGTGAAGGAGGAGGTCCAGGAGGTGAA
 
. : . : . : . : . : . :
rJMSF013L22+ TGAATTAGATGATGAGTAGGAGCTTTAATTTGCCATTGTTTTTGTAGTTCTGTTACCTAC
rJMFF015B15+ TGAATTAGATGATGAGTAGGAGCTTTAATTTGCCATTGTTTTTGTAGTTCTGTTACCTAC
                      ____________________________________________________________
consensus TGAATTAGATGATGAGTAGGAGCTTTAATTTGCCATTGTTTTTGTAGTTCTGTTACCTAC
 
. : . : . : . : . : . :
rJMSF013L22+ ATGATGACTAGTTTTGAAATTCTGTAAATGATCTGTTAGTCAACTATGCTTAAGGGAAAT
rJMFF015B15+ ATGATGACTAGTTTTGAAATTCTGTAAATGATCTGTTAGTCAACTATGCTTAAGGGAAAT
                      ____________________________________________________________
consensus ATGATGACTAGTTTTGAAATTCTGTAAATGATCTGTTAGTCAACTATGCTTAAGGGAAAT
 
. : . : . : . : . : . :
rJMSF013L22+ TCAAGTAGTGAAGCATGCACT
rJMFF015B15+ TCAAGTAGTGAAGCATGCACTTTGTTTTGAATTTTGCCATTAATGTATATGTTCTATCAA
                      ____________________________________________________________
consensus TCAAGTAGTGAAGCATGCACTTTGTTTTGAATTTTGCCATTAATGTATATGTTCTATCAA