Previous Contig 008906:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015B14Sequence540008906 (3)gb:AY086728_15717719e-12Arabidopsis thaliana clone 27081 mRNA, complete sequence.>gb:BT004961_1637907 Ar591008906 (3)gb:AY086728_15717712e-05Arabidopsis thaliana clone 27081 mRNA, complete sequence.>gb:BT004961_1637907 Ar
JMFN037C02Sequence476008906 (3)gb:AY086728_15717717e-12Arabidopsis thaliana clone 27081 mRNA, complete sequence.>gb:BT004961_1637907 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015B14+ GTACAATT
rJMFF015B14- AGTTTATGTAATCCACAACCACTGCACCTATAATACCTGCTACAGTACAATT
                      ____________________________________________________________
consensus AGTTTATGTAATCCACAACCACTGCACCTATAATACCTGCTACAGTACAATT
 
. : . : . : . : . : . :
JMFN037C02+ AATTAAATCAGAAAACAT
JMFF015B14+ TTACAGATTAAATTTTCCCATAAATGAAAAAAAAAGTTTATAAATTAAATCAGAAAACAT
rJMFF015B14- TTACAGATTAAATTTTCACATAAATGAAAAAAAAAGTTTATAAATTAAATCAGAAAACAT
                      ____________________________________________________________
consensus TTACAGATTAAATTTTCCCATAAATGAAAAAAAAAGTTTATAAATTAAATCAGAAAACAT
 
. : . : . : . : . : . :
JMFN037C02+ AATCTATATATCAATCCAATTCAGCAGGAATTGAAGAACATAATGAAAAAAAAAAACCCT
JMFF015B14+ AATNTATATATCAATCCAATTCAGCAGGAATTGAAGAACATAATG-AAAAAAAAAACCCT
rJMFF015B14- AATCTATATATCAATCCAATTCAGCAGGAATTGAAGAACATAATG-AAAAAAAAAACCCT
                      ____________________________________________________________
consensus AATCTATATATCAATCCAATTCAGCAGGAATTGAAGAACATAATG-AAAAAAAAAACCCT
 
. : . : . : . : . : . :
JMFN037C02+ AAATCAGAGCAAGAATTAAGTCTTGCGTTCAAGCTCAGTACTATCGTCCTTGAAAGATGT
JMFF015B14+ AAATCAGAGCAAGAATTAAGTCTTGCGTTCAAGCTCAGTACTATCGTCCTTGAAAGATGT
rJMFF015B14- AAATCANAGCAAGAATTAAGTCTTGCGTTCAAGCTCAGTACTATCGTCCTTGAAANATGT
                      ____________________________________________________________
consensus AAATCAGAGCAAGAATTAAGTCTTGCGTTCAAGCTCAGTACTATCGTCCTTGAAAGATGT
 
. : . : . : . : . : . :
JMFN037C02+ GGATGATGATGATGAGGCGAAGTCCTTGGGAGGAATAGGATAATAGGGCTCGCCGGCGGC
JMFF015B14+ GGATGATGATGATGAGGCGAAGTCCTTGGGAGGAATAGGATAATAGGGCTCGCCGGCGGC
rJMFF015B14- GGATGATGATGATGAGGCGAAGTCCTTGGGAGGAATAGGATAATAGGGCTCGCCGGCGGC
                      ____________________________________________________________
consensus GGATGATGATGATGAGGCGAAGTCCTTGGGAGGAATAGGATAATAGGGCTCGCCGGCGGC
 
. : . : . : . : . : . :
JMFN037C02+ GGGCAAGTCGGCGAGCGCCGCCATCATGCGGCGGATGCTGAGAGTGCGCGCCCTCTTGAA
JMFF015B14+ GGGCAAGTCGGCGAGCGCCGCCATCATGCGGCGGATGCTGAGAGTGCGCGCCCTCTTGAA
rJMFF015B14- GGGCAAGTCGGCGAGCGCCGCCATCATGCGGCGGATGCTGANAGTGCNCNCCCTCTTGAA
                      ____________________________________________________________
consensus GGGCAAGTCGGCGAGCGCCGCCATCATGCGGCGGATGCTGAGAGTGCGCGCCCTCTTGAA
 
. : . : . : . : . : . :
JMFN037C02+ GCTGAAGGATCTCGGCGGCGGCGCGTTGGAGAAGACGGCGGAAGACTTGGATAGGATGAA
JMFF015B14+ GCTGAAGGATCTCGGCGGCGGCGCGTTGGAGAAGACGGCGGAAGACTTGGATAGGATGAA
rJMFF015B14- GCTGAAGGATCTCGGCGGCGGCNCGTTGGAAAAAACGGCGGAANACTTGGATAGGATGAA
                      ____________________________________________________________
consensus GCTGAAGGATCTCGGCGGCGGCGCGTTGGAGAAGACGGCGGAAGACTTGGATAGGATGAA
 
. : . : . : . : . : . :
JMFN037C02+ GTAAACCAGAGCTTGAACTAGGAGGAAGAGCCCCACCTTCACCAACATGTCTTCGTCAAA
JMFF015B14+ GTAAACCAGAGCTTGAACTAGGAGGAAGAGCCCCACCTTCACCAACATGTCTTCGTCAAA
rJMFF015B14- GTAAACCANAGCTTGAACTAGGAGGAANAGCCCCACCTTCACCAACATGTCTTCGTCAAA
                      ____________________________________________________________
consensus GTAAACCAGAGCTTGAACTAGGAGGAAGAGCCCCACCTTCACCAACATGTCTTCGTCAAA
 
. : . : . : . : . : . :
JMFN037C02+ CTCCATTTTTCTATTGATTTCTGAGAAATAAAATAAAATCGAGAAAAAATATTGAGAGGT
JMFF015B14+ CTCCATTTTTCTATTGATTTCTGAGAAATAAAATAAAATCGAGAAAAAATATTGAGAGGT
rJMFF015B14- CTCCATTTTTCTATTGATTTCTGANAAATAAAATAAAATCGANAAAAAATATTGAGAGGT
                      ____________________________________________________________
consensus CTCCATTTTTCTATTGATTTCTGAGAAATAAAATAAAATCGAGAAAAAATATTGAGAGGT
 
. : . : . : . : . : . :
JMFN037C02+ TGTGATTGAATTGGAACACCAAAAGATGATGATGAGGA
JMFF015B14+ TGTGATTGAATTGGAACACCAAAAGATGATGATGAGGATTGAGGATGAAGGAT
rJMFF015B14- TGTGATTGAATTGGAACNCCAAAAGATGATGATGAGGATTGAGGATGAAGGATCGGTTCT
                      ____________________________________________________________
consensus TGTGATTGAATTGGAACACCAAAAGATGATGATGAGGATTGAGGATGAAGGATCGGTTCT