Previous Contig 008903:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F12Sequence570000240 (6)gb:AC144791_17442598e-63Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence774008903 (10)gb:AC151802_17451107e-89Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMFF009K09Sequence600000240 (6)gb:AC144791_17442595e-68Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence755008903 (10)gb:AC151802_17451103e-72Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMFF014P09Sequence606000240 (6)gb:AC144791_17442595e-72Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence767008903 (10)gb:AC151802_17451101e-75Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMFF026A06Sequence415001229 (4)645008903 (10)gb:AC151802_17451102e-65Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMFF032P05Sequence614001229 (4)gb:AC144791_17442592e-22Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence782008903 (10)gb:AC151802_17451108e-90Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMFF040M03Sequence435000240 (6)gb:AC144791_17442591e-35Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence754008903 (10)gb:AC151802_17451102e-90Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMSF008M11Sequence281001229 (4)755008903 (10)gb:AC151802_17451104e-89Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMSF011L06Sequence387000240 (6)gb:AC144791_17442594e-28Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence789008903 (10)gb:AC151802_17451108e-79Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.
JMSF039K09Sequence671008903 (10)gb:AC151802_17451103e-99Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.943008903 (10)gb:AC151802_1745110e-103Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039K09- GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
JMSF039K09- GATCGCTAAACTTCTGTGTTGGGAGAAGAAGTCCGAGAAGGGCGAAATTGCGATTTGGCA
                      ____________________________________________________________
consensus GATCGCTAAACTTCTGTGTTGGGAGAAGAAGTCCGAGAAGGGCGAAATTGCGATTTGGCA
 
. : . : . : . : . : . :
JMSF039K09- GGAGAGGATGGATGTTGATTCGTGTCGAGCTTCACAAAAGAAGTCCAAAGCTACTTTTTG
                      ____________________________________________________________
consensus GGAGAGGATGGATGTTGATTCGTGTCGAGCTTCACAAAAGAAGTCCAAAGCTACTTTTTG
 
. : . : . : . : . : . :
JMSF039K09- TCAATCTGGTGATCCAGACGACGTCTGGTATAAGAAAATGGACGTATGCATAACTCCA-T
rJMSF039K09+ GAAAATNGACGTATGCATAACTCCATT
                      ____________________________________________________________
consensus TCAATCTGGTGATCCAGACGACGTCTGGTATAAGAAAATGGACGTATGCATAACTCCATT
 
. : . : . : . : . : . :
JMSF039K09- CTCCCAAAGCAAACATTGACGAGTCTCTCAAGAAATTCCCGGAAAGACTTACCGCTATTC
rJMSF039K09+ TTCCCAAAGCAAACATTGACGAGTCTTTCAAGAAATTCCCGGAAAGACTTACCGCTATTC
                      ____________________________________________________________
consensus TTCCCAAAGCAAACATTGACGAGTCTTTCAAGAAATTCCCGGAAAGACTTACCGCTATTC
 
. : . : . : . : . : . :
JMSF039K09- CCCCAAGAATTGCTAACGGGTTGGTTTCGGGAGTCTCAGCTGAGGCATATCTCGACGACA
rJMSF008M11+ ACGACA
rJMFF032P05+ TCGACGACA
rJMFF009F12+ A
rJMFF040M03+ TCGACGACA
rJMSF039K09+ CCCCAAGAATTGCTAACGGGTTGGTTTCGGGAGTCTCAGCTGAGGCATATCTCGACGACA
                      ____________________________________________________________
consensus CCCCAAGAATTGCTAACGGGTTGGTTTCGGGAGTCTCAGCTGAGGCATATCTCGACGACA
 
. : . : . : . : . : . :
JMSF039K09- ACAAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
rJMSF008M11+ ACCAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
rJMFF032P05+ ACAAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
rJMFF009F12+ ACAAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
rJMSF011L06+ TGGAAGAAGCACGTTAGTGCNTACAAAAGAATCAATAAGATTATCGACACGG
rJMFF040M03+ ACAAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
rJMSF039K09+ ACAAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
                      ____________________________________________________________
consensus ACAAGAAGTGGAAGAAGCACGTTAGTGCTTACAAAAGAATCAATAAGATTATCGACACGG
 
. : . : . : . : . : . :
JMSF039K09- G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMSF008M11+ G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMFF032P05+ G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMFF009F12+ G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMSF011L06+ GNANGGTATCGCAACCATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMFF040M03+ G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMSF039K09+ G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMFF009K09+ TATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
rJMFF014P09+ TCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
                      ____________________________________________________________
consensus G-AAGGTATCGCAA-CATTATGGATATGAATGCGGGATTGGGAGGTTTTGCTGCGCAGCT
 
. : . : . : . : . : . :
JMSF039K09- TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMSF008M11+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMFF032P05+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMFF026A06+ AAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMFF009F12+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMSF011L06+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCCACAATTGCTGATAAAAGTACTTT
rJMFF040M03+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMSF039K09+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMFF009K09+ TACGTCTCCTAAACAGTGAGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
rJMFF014P09+ TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
                      ____________________________________________________________
consensus TACGTCTCCTAAACAGTGGGTTATGAATGTCGTTCCTACAATTGCTGATAAAAGTACTTT
 
. : . : . : . : . : . :
JMSF039K09- GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMSF008M11+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMFF032P05+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMFF026A06+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMFF009F12+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMSF011L06+ GGGTGTTATATATGGACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMFF040M03+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMSF039K09+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMFF009K09+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
rJMFF014P09+ GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
                      ____________________________________________________________
consensus GGGTGTTATATATGAACGAGGAATGATCGGTATCTACCATGACTGGTGTGAAGGCTTCTC
 
. : . : . : . : . : . :
JMSF039K09- CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMSF008M11+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMFF032P05+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMFF026A06+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMFF009F12+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMSF011L06+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMFF040M03+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMSF039K09+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMFF009K09+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
rJMFF014P09+ CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
                      ____________________________________________________________
consensus CACGTACCCGAGGACTTATGATCTCATTCACGCTAATGGTGTCTTTAGCTTGTACAAGGA
 
. : . : . : . : . : . :
JMSF039K09- CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMSF008M11+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMFF032P05+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMFF026A06+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMFF009F12+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMSF011L06+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMFF040M03+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMSF039K09+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMFF009K09+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
rJMFF014P09+ CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
                      ____________________________________________________________
consensus CAAGTGTGATTTCGAGGACATTCTTTTGGAAATGGACAGGATTTTACGCCCGGAAGGCGC
 
. : . : . : . : . : . :
JMSF039K09- GGTCGTTTTCAG
rJMSF008M11+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMFF032P05+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMFF026A06+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMFF009F12+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMSF011L06+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMFF040M03+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMSF039K09+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMFF009K09+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
rJMFF014P09+ GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
                      ____________________________________________________________
consensus GGTCGTTTTCAGAGACGAAGTCGACACGCTGATCAAGGTGAGGAGGATCATAGGAGGTAT
 
. : . : . : . : . : . :
rJMSF008M11+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMFF032P05+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMFF026A06+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMFF009F12+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMSF011L06+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMFF040M03+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMSF039K09+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMFF009K09+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
rJMFF014P09+ GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
                      ____________________________________________________________
consensus GAGATGGGACTACAAACTGATGGACCATGAAGACGGTCCCCTCGTGCCCGAGAAAATACT
 
. : . : . : . : . : . :
rJMSF008M11+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMFF032P05+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMFF026A06+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMFF009F12+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMSF011L06+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMFF040M03+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMSF039K09+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMFF009K09+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
rJMFF014P09+ AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
                      ____________________________________________________________
consensus AGTCGCGGTGAAAAAGTATTGGACTTTGAACGACACGAACTCCACATCCGCGCAATGAGG
 
. : . : . : . : . : . :
rJMSF008M11+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMFF032P05+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMFF026A06+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMFF009F12+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMSF011L06+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMFF040M03+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMSF039K09+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMFF009K09+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
rJMFF014P09+ AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
                      ____________________________________________________________
consensus AGTACCCGAGGGAGAGGCGAGGAATGACCGGTGCGATGGTGTAGATTACGAGCATGAATG
 
. : . : . : . : . : . :
rJMSF008M11+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMFF032P05+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMFF026A06+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMFF009F12+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMSF011L06+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMFF040M03+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMSF039K09+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMFF009K09+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
rJMFF014P09+ GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
                      ____________________________________________________________
consensus GAAAGCTTTCACCACTTGAAGAAGCATTTTTGCCACAAGAAATTGTTGGAGCATTAGGGT
 
. : . : . : . : . : . :
rJMSF008M11+ TTGGTTTGCATTTGGGTGTCTGTACCATGAACCATGTTGTTTATTGCTCCACCAAACTAT
rJMFF032P05+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMFF026A06+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMFF009F12+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMSF011L06+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMFF040M03+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMSF039K09+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMFF009K09+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
rJMFF014P09+ TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
                      ____________________________________________________________
consensus TTGGTTTGCATTTGGGTGTCTGTACCATGAA-CATGTTGTTTATTGCTCCA-CAAACTAT
 
. : . : . : . : . : . :
rJMSF008M11+ ACATACCATGGAGCCC
rJMFF032P05+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAAC
rJMFF026A06+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAAC
rJMFF009F12+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAAC
rJMSF011L06+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAANCA
rJMFF040M03+ ACATA-CATGGAGCCCTGTAACATTA
rJMSF039K09+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAANCA
rJMFF009K09+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAA-CA
rJMFF014P09+ ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAA-CA
                      ____________________________________________________________
consensus ACATA-CATGGAGCCCTGTAACATTATGCTTTAGATCTGTGCACTACGTCTCGAAAACCA
 
. : . : . : . : . : . :
rJMSF011L06+ GTGTTGTTTCACACTTTCGC
rJMSF039K09+ GTGTTGTTTCACACTTTCGCT
rJMFF009K09+ GTGTTGTTTCACACTTTCGCTAGACGGGACACATTTTTCAATTTGGTACAAAAAGTC
rJMFF014P09+ GTGTTGTTTCACACTTTCGCTAGACGGGACACATTTTTCAATTTGGTACAAAAAGTCGCG
                      ____________________________________________________________
consensus GTGTTGTTTCACACTTTCGCTAGACGGGACACATTTTTCAATTTGGTACAAAAAGTCGCG