Previous Contig 008900:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014O22Sequence479008900 (4)gb:AY341443_16007692e-44Phaseolus vulgaris cultivar Sprite BAC 78L17, partial sequence.745008900 (4)gb:AY085712_15707799e-56Arabidopsis thaliana clone 17250 mRNA, complete sequence.
JMFF034O06Sequence541008900 (4)gb:AY341443_16007695e-52Phaseolus vulgaris cultivar Sprite BAC 78L17, partial sequence.697008900 (4)gb:AY341443_16007694e-55Phaseolus vulgaris cultivar Sprite BAC 78L17, partial sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014O22- ATTCTCCTACTCTTTCATCTTCTTGAGCAAAAGATTG
JMFF034O06- ATTCTCCTACTCTTTCATCTTCTTGAGCAAAAGATTG
                      ____________________________________________________________
consensus ATTCTCCTACTCTTTCATCTTCTTGAGCAAAAGATTG
 
. : . : . : . : . : . :
JMFF014O22- GGAAGCCAAGAGATTTGTGGTTTGCTCAAGATTTCTGGCCAAAATGACATATTGTGTTGT
JMFF034O06- GGAAGCCAAGAGATTTGTGGTTTGCTCAAGATTTCTGGCCAAAATGACATATTGTGTTGT
                      ____________________________________________________________
consensus GGAAGCCAAGAGATTTGTGGTTTGCTCAAGATTTCTGGCCAAAATGACATATTGTGTTGT
 
. : . : . : . : . : . :
JMFF014O22- GCTAGTGGCATTCTTGCTTTCTTGCTTCAGTTTCACTTCAACAGATGCTTATGATCCATC
JMFF034O06- GCTAGTGGCATTCTTGCTTTCTTGCTTCAGTTTCACTTCAACAGATGCTTATGATCCATC
                      ____________________________________________________________
consensus GCTAGTGGCATTCTTGCTTTCTTGCTTCAGTTTCACTTCAACAGATGCTTATGATCCATC
 
. : . : . : . : . : . :
JMFF014O22- TGACCCCTACGGAAACATCACAATAAAAACAGATGTTCTCAGCTCGACTCCTGATGGTTA
JMFF034O06- TGACCCCTACGGAAACATCACAATAAAAACAGATGTTCTCAGCTCGACTCCTGATGGTTA
                      ____________________________________________________________
consensus TGACCCCTACGGAAACATCACAATAAAAACAGATGTTCTCAGCTCGACTCCTGATGGTTA
 
. : . : . : . : . : . :
JMFF014O22- TGTTGCTGTTGTGACGATTTACAACTTTCAGCAACACAGGCGAATTGAAGCGCCGGGTTG
JMFF034O06- TGTTGCTGTTGTGACGATTTACAACTTTCAGCAACACAGGCGAATTGAAGCGCCGGGTTG
rJMFF034O06+ TGAAGCGCCGGGTTG
rJMFF014O22+ ACAGGCGAATTGAAGCGCCGGGTTG
                      ____________________________________________________________
consensus TGTTGCTGTTGTGACGATTTACAACTTTCAGCAACACAGGCGAATTGAAGCGCCGGGTTG
 
. : . : . : . : . : . :
JMFF014O22- GAATCTGGGATGGACATGGTCGAAGAAAGAGGTGATATGGAGCATGGTGGGCGGTGAAAC
JMFF034O06- GAATCTGGGATGGACATGGTCGAAGAAAGAGGTGATATGGAGCATGGTGGGCGGTGAAAC
rJMFF034O06+ GAATCTGGGATGGACATGGTCGAAGAAAGAGGTGATATGGAGCATGGTGGGCGGTGAAAC
rJMFF014O22+ GAATCTGGGATGGACATGGTCGAAGAAAGAGGTGATATGGAGCATGGTGGGCGGTGAAAC
                      ____________________________________________________________
consensus GAATCTGGGATGGACATGGTCGAAGAAAGAGGTGATATGGAGCATGGTGGGCGGTGAAAC
 
. : . : . : . : . : . :
JMFF014O22- CATGGTGTCTGAAGAATGTTTTAGGTTCAATAGCTCCAATCCTCCACAATCATGCACAAA
JMFF034O06- CATGGTGTCTGAAGAATGTTTTAGGTTCAATAGCTCCAATCCTCCACAATCATGCACAAA
rJMFF034O06+ CATGGTGTCTGAAGAATGTTTTAGGTTCAATAGCTCCAATCCTCCACAATCATGCACAAA
rJMFF014O22+ CATGGTGTCTGAAGAATGTTTTAGGTTCAATAGCTCCAATCCTCCACAATCATGCACAAA
                      ____________________________________________________________
consensus CATGGTGTCTGAAGAATGTTTTAGGTTCAATAGCTCCAATCCTCCACAATCATGCACAAA
 
. : . : . : . : . : . :
JMFF014O22- GCACCCAAGATTCGTTGACTTATCCCCTAGTGCTCCTTACAATCAGCAGATTGCAGATTG
JMFF034O06- GCACCCAAGATTCGTTGACTTATCCCCTAGTGCTCCTTACAATCAGCAGATTGCAGATTG
rJMFF034O06+ GCACCCAAGATTCGTTGACTTATCCCCTAGTGCTCCTTACAATCAGCAGATTGCAGATTG
rJMFF014O22+ GCACCCAAGATTCGTTGACTTATCCCCTAGTGCTCCTTACAATCAGCAGATTGCAGATTG
                      ____________________________________________________________
consensus GCACCCAAGATTCGTTGACTTATCCCCTAGTGCTCCTTACAATCAGCAGATTGCAGATTG
 
. : . : . : . : . : . :
JMFF014O22- CTGTAAGGGTGGAGTGCTTAGT
JMFF034O06- CTGTAAGGGTGGAGTGCTTAGTGCATGGGGGGAAGATGCTGCCAATGCTGTAAGCTCATT
rJMFF034O06+ CTGTAAGGGTGGAGTGCTTAGTGCATGGGGGGAAGATGCTGCCAATGCTGTAAGCTCATT
rJMFF014O22+ CTGTAAGGGTGGAGTGCTTAGTGCATGGGGGGAAGATGCTGCCAATGCTGTAAGCTCATT
                      ____________________________________________________________
consensus CTGTAAGGGTGGAGTGCTTAGTGCATGGGGGGAAGATGCTGCCAATGCTGTAAGCTCATT
 
. : . : . : . : . : . :
JMFF034O06- CCAAATCACCGTTGGGGCAGCCGG
rJMFF034O06+ CCAAATCACCGTTGGGGCAGCCGGGACCACTAACAGAACCGTGAGGATGCCTAAGAACTT
rJMFF014O22+ CCAAATCACCGTTGGGGCAGCCGGGACCACTAACAGAACCGTGAGGATGCCTAAGAACTA
                      ____________________________________________________________
consensus CCAAATCACCGTTGGGGCAGCCGGGACCACTAACAGAACCGTGAGGATGCCTAAGAACTT
 
. : . : . : . : . : . :
rJMFF034O06+ CACATTTTTTGCGCCAGGACCTGGTGGTTATACCTGTGGACCAGCCAAAATTGTTAGACA
rJMFF014O22+ CACATTTTTTGCGCCAGGACCTGGTGGTTATACCTGTGGACCAGCCAAAATTGTTAGACA
                      ____________________________________________________________
consensus CACATTTTTTGCGCCAGGACCTGGTGGTTATACCTGTGGACCAGCCAAAATTGTTAGACA
 
. : . : . : . : . : . :
rJMFF034O06+ AACAAAGTTGGTTACTCCAGATCTGAGAAGATTGTATCGTGCAATGATGACTTGGAACGT
rJMFF014O22+ AACAAAGTTGGTTACTCCAGATCTGAGAAGATTGTATCGTGCAATGATGACTTGGAACGT
                      ____________________________________________________________
consensus AACAAAGTTGGTTACTCCAGATCTGAGAAGATTGTATCGTGCAATGATGACTTGGAACGT
 
. : . : . : . : . : . :
rJMFF034O06+ GACCTGCATGTATTCAGCATTCCTAGGTTACAAATATAGTTCGGGGAGTATCGCCTTAGC
rJMFF014O22+ GACCTGCATGTATTCAGCATTCCTAGGTTACAAATATAGTTCGGGGAGTATCGCCTTAGC
                      ____________________________________________________________
consensus GACCTGCATGTATTCAGCATTCCTAGGTTACAAATATAGTTCGGGGAGTATCGCCTTAGC
 
. : . : . : . : . : . :
rJMFF034O06+ TCCTGGTCCTGATCCAGGTACTCGGTCTGCTCCAAATCTCGCACCTATAGCTACCGTGAC
rJMFF014O22+ TCCTGGTCCTGATCCAGGTACTCGGTCTGCTCCAAATCTCGCACCTATAGCTACCGTGAC
                      ____________________________________________________________
consensus TCCTGGTCCTGATCCAGGTACTCGGTCTGCTCCAAATCTCGCACCTATAGCTACCGTGAC
 
. : . : . : . : . : . :
rJMFF034O06+ AGATTCACTCAGCCCAGCACCGCTTCCTTCTTCTTTCTCTTCTTGTTCTCCATCTTTCTC
rJMFF014O22+ AGATTCACTCAGCCCAGCACCGCTTCCTTCTTCTTTCTCTTCTTGTTCTCCATCTTTCTC
                      ____________________________________________________________
consensus AGATTCACTCAGCCCAGCACCGCTTCCTTCTTCTTTCTCTTCTTGTTCTCCATCTTTCTC
 
. : . : . : . : . : . :
rJMFF034O06+ CCTTTTATCTTTCTTTCTTGTTTCTGTCTTTCTTTGCTCTTTGCAGTCTGTGATGTGATT
rJMFF014O22+ CCTTTTATCTTTCTTTCTTGTTTCTGTCTTTCTTTGCTCTTTGCAGTCTGTGATGTGATT
                      ____________________________________________________________
consensus CCTTTTATCTTTCTTTCTTGTTTCTGTCTTTCTTTGCTCTTTGCAGTCTGTGATGTGATT
 
. : . : . : . : . : . :
rJMFF034O06+ TAATTTCTTCTTGGTTTTGGTT
rJMFF014O22+ TAATTTCTTCTTGGTTTTGGTTCCCTGGAAGCATATTCTTGGACATGCAATATAAAAAAA
                      ____________________________________________________________
consensus TAATTTCTTCTTGGTTTTGGTTCCCTGGAAGCATATTCTTGGACATGCAATATAAAAAAA