Previous Contig 008899:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014O14Sequence581005102 (5)pir|T47595|T475951e-27RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido776008899 (4)pir|T47595|T475952e-71RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido
JMSF009E09Sequence491005102 (5)pir|T47595|T475952e-15RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido796008899 (4)pir|T47595|T475951e-72RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido
JMSF009L10Sequence472005102 (5)pir|T47595|T475956e-07RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido764008899 (4)pir|T47595|T475952e-68RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido
JMSF027F19Sequence637005102 (5)pir|T47595|T475953e-36RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido755008899 (4)pir|T47595|T475958e-71RING finger protein T12E18.50 - Arabidopsis thaliana>gb:ATT12E18_1554324 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009E09+ ATATATGAGGATGTGTCTTGGAANGAGGCTCT
                      ____________________________________________________________
consensus ATATATGAGGATGTGTCTTGGAANGAGGCTCT
 
. : . : . : . : . : . :
rJMSF009E09+ TCCTGGTGCATCATGCCATGCGAGCATTTCGTGCAAATAATGTTGAAAGTGCAAAATCAA
rJMSF027F19+ TGCATCATGCCATGCGAGCATTTCGTGCAAATAATGGTGAAAGTGCAAAATCAA
rJMSF009L10+ TGCATCATGCCATGCGAGCA-TTCGTGCAAATAATGTTGAAAGTGCAAAATCAA
rJMFF014O14+ TGCATCATGCCATGCGAGCATTTCGTGCAAATAATGTTGAAAGTGCAAAATCAA
                      ____________________________________________________________
consensus TCCTGGTGCATCATGCCATGCGAGCATTTCGTGCAAATAATGTTGAAAGTGCAAAATCAA
 
. : . : . : . : . : . :
rJMSF009E09+ GACTTAGCATATGTGCAGAAGATATTCGAGAACAAGTAGAAAGAATGGGAAATACATCAG
rJMSF027F19+ GACTTAGCATATGTGCAGAAGATATTCGAGAACAAGTAGAAAGAATGGGAAATACATCAG
rJMSF009L10+ GACTTAGCATATGTGCAGAAGATATTCGAGAACAAGTAGAAAGAATGGGAAATACATCAG
rJMFF014O14+ GACTTAGCATATGTGCAGAAGATATTCGAGAACAAGTAGAAAGAATGGGAAATACATCAG
                      ____________________________________________________________
consensus GACTTAGCATATGTGCAGAAGATATTCGAGAACAAGTAGAAAGAATGGGAAATACATCAG
 
. : . : . : . : . : . :
rJMSF009E09+ AACTGTGCTCACAACTTGGAGCAGTTCTGGGTATGCTTGGTGATTGCTGCCGAGCTACAG
rJMSF027F19+ AACTGTGCTCACAACTTGGAGCAGTTCTGGGTATGCTTGGTGATTGCTGCCGAGCTACAG
rJMSF009L10+ AACTGTGCTCACAACTTGGAGCAGTTCTGGGTATGCTTGGTGATTGCTGCCGAGCTACAG
rJMFF014O14+ AACTGTGCTCACAACTTGGAGCAGTTCTGGGTATGCTTGGTGATTGCTGCCGAGCTACAG
                      ____________________________________________________________
consensus AACTGTGCTCACAACTTGGAGCAGTTCTGGGTATGCTTGGTGATTGCTGCCGAGCTACAG
 
. : . : . : . : . : . :
rJMSF009E09+ GAGATGCCGCTTCTGCAGTCAAATATTTTGAAGAGAGTGTCAATTTTCTTTTAAAAGTGC
rJMSF027F19+ GAGATGCCGCTTCTGCAGTCAAATATTTTGAAGAGAGTGTCAATTTTCTTTTAAAAGTGC
rJMSF009L10+ GAGATGCCGCTTCTGCAGTCAAATATTTTGAAGAGAGTGTCAATTTTCTTTTAAAAGTGC
rJMFF014O14+ GAGATGCCGCTTCTGCAGTCAAATATTTTGAAGAGAGTGTCAATTTTCTTTTAAAAGTGC
                      ____________________________________________________________
consensus GAGATGCCGCTTCTGCAGTCAAATATTTTGAAGAGAGTGTCAATTTTCTTTTAAAAGTGC
 
. : . : . : . : . : . :
rJMSF009E09+ CTAAAGATGATTTAGAGATAACACACACTCTTTCTGTCTCTCTAAATAAAATTGGAGACC
rJMSF027F19+ CTAAAGATGATTTAGAGATAACACACACTCTTTCTGTCTCTCTAAATAAAATTGGAGACC
rJMSF009L10+ CTAAAGATGATTTAGAGATAACACACACTCTTTCTGTCTCTCTAAATAAAATTGGAGACC
rJMFF014O14+ CTAAAGATGATTTAGAGATAACACACACTCTTTCTGTCTCTCTAAATAAAATTGGAGACC
                      ____________________________________________________________
consensus CTAAAGATGATTTAGAGATAACACACACTCTTTCTGTCTCTCTAAATAAAATTGGAGACC
 
. : . : . : . : . : . :
rJMSF009E09+ TTAAATACTATGATGAAGATTTGCAAGCTGCAAGATCATATTATTTTCAAGCATTGGATA
rJMSF027F19+ TTAAATACTATGATGAAGATTTGCAAGCTGCAAGATCATATTATTTTCAAGCATTGGATA
rJMSF009L10+ TTAAATACTATGATGAAGATTTGCAAGCTGCAAGATCATATTATTTTCAAGCATTGGATA
rJMFF014O14+ TTAAATACTATGATGAAGATTTGCAAGCTGCAAGATCATATTATTTTCAAGCATTGGATA
                      ____________________________________________________________
consensus TTAAATACTATGATGAAGATTTGCAAGCTGCAAGATCATATTATTTTCAAGCATTGGATA
 
. : . : . : . : . : . :
rJMSF009E09+ TTCGCCGCAATGCCATCAAGCAGCATTCTCAACCATCTCAGACCATAGATGTGGCCGTAT
rJMSF027F19+ TTCGCCGCAATGCCATCAAGCAGCATTCTCAACCATCTCAGACCATAGATGTGGCCGTAT
rJMSF009L10+ TTCGCCGCAATGCCATCAAGCAGCATTCTCAACCATCTCAGACCATAGATGTGGCCGTAT
rJMFF014O14+ TTCGCCGCAATGCCATCAAGCAGCATTCTCAACCATCTCAGACCATAGATGTGGCCGTAT
                      ____________________________________________________________
consensus TTCGCCGCAATGCCATCAAGCAGCATTCTCAACCATCTCAGACCATAGATGTGGCCGTAT
 
. : . : . : . : . : . :
rJMSF009E09+ CACTTGCAAAAGTAGCTGATGTGGACAGAAATATTGGGAATGAGAAAACTGCAGTAGATG
rJMSF027F19+ CACTTGCAAAAGTAGCTGATGTGGACAGAAATATTGGGAATGAGAAAACTGCAGTAGATG
rJMSF009L10+ CACTTGCAAAAGTAGCTGATGTGGACAGAAATATTGGGAATGAGAAAACTGCAGTAGATG
rJMFF014O14+ CACTTGCAAAAGTAGCTGATGTGGACAGAAATATTGGGAATGAGAAAACTGCAGTAGATG
                      ____________________________________________________________
consensus CACTTGCAAAAGTAGCTGATGTGGACAGAAATATTGGGAATGAGAAAACTGCAGTAGATG
 
. : . : . : . : . : . :
rJMSF009E09+ GATTTCAAGAAGCCATAGAAATGCTGCAATGTCTGAAACTAAATCCTGAAGAAGTTGGCC
rJMSF027F19+ GATTTCAAGAAGCCATAGAAATGCTGCAATGTCTGAAACTAAATCCTGAAGAAGTTGGCC
rJMSF009L10+ GATTTCAAGAAGCCATAGAAATGCTGCAATGTCTGAAACTAAATCCTGAAGAAGTTGGCC
rJMFF014O14+ GATTTCAAGAAGCCATAGAAATGCTGCAATGTCTGAAACTAAATCCTGAAGAAGTTGGCC
                      ____________________________________________________________
consensus GATTTCAAGAAGCCATAGAAATGCTGCAATGTCTGAAACTAAATCCTGAAGAAGTTGGCC
 
. : . : . : . : . : . :
rJMSF009E09+ TTGAACAGCGGAGATTGTCGGTGCTCGAGTTCCTTAACAGTCAGCTTGGCAAGAAAGAGA
rJMSF027F19+ TTGAACAGCGGAGATTGTCGGTGCTCGAGTTCCTTAACAGTCAGCTTGGCAAGAAAGAGA
rJMSF009L10+ TTGAACAGCGGAGATTGTCGGTGCTCGAGTTCCTTAACAGTCAGCTTGGCAAGAAAGAGA
rJMFF014O14+ TTGAACAGCGGAGATTGTCGGTGCTCGAGTTCCTTAACAGTCAGCTTGGCAAGAAAGAGA
                      ____________________________________________________________
consensus TTGAACAGCGGAGATTGTCGGTGCTCGAGTTCCTTAACAGTCAGCTTGGCAAGAAAGAGA
 
. : . : . : . : . : . :
rJMSF009E09+ CCAACTCAGGTTCTTGAGTGAAGATTTTCGTCTGTCCTTACGAGGGACCAACGTAAGAAA
rJMSF027F19+ CCAACTCAGGTTCTTGAGTGAAGATTTTCGTCTGTCCTTACGAGGGACCAACGTAAGAAA
rJMSF009L10+ CCAACTCAGGTTCTTGAGTGAAGATTTTCGTCTGTCCTTACGAGGGACCAACGTAAGAAA
rJMFF014O14+ CCAACTCAGGTTCTTGAGTGAAGATTTTCGTCTGTCCTTACGAGGGACCAACGTAAGAAA
                      ____________________________________________________________
consensus CCAACTCAGGTTCTTGAGTGAAGATTTTCGTCTGTCCTTACGAGGGACCAACGTAAGAAA
 
. : . : . : . : . : . :
rJMSF009E09+ TATCTCTTTGTAAATGACTTGGAAATAAGTGATAGGTATTTCCATTA-CCTTGTTATATT
rJMSF027F19+ TATCTCTTTGTAAATGACTTGGAAATAAGTGATAGGTATTTCCATTA-CCTTGTTATATT
rJMSF009L10+ TATCTCTTTGTAAATGACTTGGAAATAAGTGATAGGTATTTCCATTACCCTTGTTATATT
rJMFF014O14+ TATCTCTTTGTAAATGACTTGGAAATAAGTGATAGGTATTTCCATTA-CCTTGTTATATT
                      ____________________________________________________________
consensus TATCTCTTTGTAAATGACTTGGAAATAAGTGATAGGTATTTCCATTA-CCTTGTTATATT
 
. : . : . : . : . : . :
rJMSF009E09+ GTAACTCTGTGATATTTTCTAACTAGTACCCCCACGCT
rJMSF027F19+ GTAACTCTGTGATATTTTCTAACTAGTACCCCCACGCT
rJMSF009L10+ GTAACTCTGTGATATTTTCTAACTAGTACCCCCACGCT
rJMFF014O14+ GTAACTCTGTGATATTTTCTAACTAGTACCCCCACGCTTGAATGTTACAAAAAGAAATAA
                      ____________________________________________________________
consensus GTAACTCTGTGATATTTTCTAACTAGTACCCCCACGCTTGAATGTTACAAAAAGAAATAA