Previous Contig 008897:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014O02Sequence577000765 (3)789008897 (2)pir|T06521|T065213e-33pitrilysin (EC 3.4.24.55) - garden pea>gb:PSU25111_1702477 Pisum sativum chlorop
JMSF044P08Sequence691020276pir|T06521|T065212e-77pitrilysin (EC 3.4.24.55) - garden pea>gb:PSU25111_1702477 Pisum sativum chlorop757008897 (2)pir|T06521|T065212e-27pitrilysin (EC 3.4.24.55) - garden pea>gb:PSU25111_1702477 Pisum sativum chlorop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014O02+ GGCTTGGGTTG
                      ____________________________________________________________
consensus GGCTTGGGTTG
 
. : . : . : . : . : . :
rJMSF044P08+ AGCTCATTTGCCAAGCTGCATCAGTACTCAGGAAAGGACATCTCATGTATTAAAGAGC
rJMFF014O02+ TTAGCTCATTTG-CAAGCTGCATCAGTACTCAGG-AAGGACATCTCATGTATTAAAGAGC
                      ____________________________________________________________
consensus TTAGCTCATTTGCCAAGCTGCATCAGTACTCAGGAAAGGACATCTCATGTATTAAAGAGC
 
. : . : . : . : . : . :
rJMSF044P08+ TGACTTCACTATATGAAGCTGCCACTATTGAAGACATATATGTTGCCTATGAACAGTTGA
rJMFF014O02+ TGACTTCACTATATGAAGCTGCCACTATTGAAGACATATATGTTGCCTATGAACAGTTGA
                      ____________________________________________________________
consensus TGACTTCACTATATGAAGCTGCCACTATTGAAGACATATATGTTGCCTATGAACAGTTGA
 
. : . : . : . : . : . :
rJMSF044P08+ AGATAGATGAAAATTCCCTGTTCTCTTGCATTGGAATTGCTGGGGTAAATGCTGGAGAAG
rJMFF014O02+ AGATAGATGAAAATTCCCTGTTCTCTTGCATTGGAATTGCTGGGGTAAATGCTGGAGAAG
                      ____________________________________________________________
consensus AGATAGATGAAAATTCCCTGTTCTCTTGCATTGGAATTGCTGGGGTAAATGCTGGAGAAG
 
. : . : . : . : . : . :
rJMSF044P08+ ACATATCAGTACCTATAGAAGAGGAAGATTCAATCGATGGCCTTCCTAATGTTATTCCCA
rJMFF014O02+ ACATATCAGTACCTATAGAAGAGGAAGATTCAATCGATGGCCTTCCTAATGTTATTCCCA
                      ____________________________________________________________
consensus ACATATCAGTACCTATAGAAGAGGAAGATTCAATCGATGGCCTTCCTAATGTTATTCCCA
 
. : . : . : . : . : . :
rJMSF044P08+ TGGGACGTGGTTCATCTACAATGACACGGCCAACAACTTGAGGGGTGGTAGAAATTCTTT
rJMFF014O02+ TGGGACGTGGTTCATCTACAATGACACGGCCAACAACTTGAGGGGTGGTAGAAATTCTTT
                      ____________________________________________________________
consensus TGGGACGTGGTTCATCTACAATGACACGGCCAACAACTTGAGGGGTGGTAGAAATTCTTT
 
. : . : . : . : . : . :
rJMSF044P08+ GAAAGACAGATTGTATGAGTGACCTATAGGACACTTGTCAGTGCTTTTGCTGGGTAGAAG
rJMFF014O02+ GAAAGACAGATTGTATGAGTGACCTATAGGACACTTGTCAGTGCTTTTGCTGGGTAGAAA
                      ____________________________________________________________
consensus GAAAGACAGATTGTATGAGTGACCTATAGGACACTTGTCAGTGCTTTTGCTGGGTAGAAG
 
. : . : . : . : . : . :
rJMSF044P08+ CCGTATGTCCACTGGCAGAATGTGTTATATATGCCCTTGACAGGGTTGTGCAGTCATTTC
rJMFF014O02+ CCGTATGTCCACTGGCAGAATGTGTTATATATGCCCTTGACAGGGTTGTGCAGTCATTTC
                      ____________________________________________________________
consensus CCGTATGTCCACTGGCAGAATGTGTTATATATGCCCTTGACAGGGTTGTGCAGTCATTTC
 
. : . : . : . : . : . :
rJMSF044P08+ CAACCATAGAGAAGGTGCAGGACAGCAAGCTGCCACTCGCTACGGTATACAGATTAAGTC
rJMFF014O02+ CAACCATAGAGAAGGTGCAGGACAGCAAGCTGCCACTCGCTACGGTATACAGATTAAGTC
                      ____________________________________________________________
consensus CAACCATAGAGAAGGTGCAGGACAGCAAGCTGCCACTCGCTACGGTATACAGATTAAGTC
 
. : . : . : . : . : . :
rJMSF044P08+ TTGGTGCTGACTCGACGCTAGGGCTTCATGAGATTACTAGGTCCCCATTGGTTATGGCAT
rJMFF014O02+ TTGGTGCTGACTCGACGCTAGGGCTTCATGAGATTACTAGGTCCCCATTGGTTATGGCAT
                      ____________________________________________________________
consensus TTGGTGCTGACTCGACGCTAGGGCTTCATGAGATTACTAGGTCCCCATTGGTTATGGCAT
 
. : . : . : . : . : . :
rJMSF044P08+ TGAATGGACAGAAGTATAGTCTAACTTTAGTGAAACTACAATTTCATATGTACCCAAGTA
rJMFF014O02+ TGAATGGACAGAAGTATAGTCTAACTTTAGTGAAACTACAATTTCATATGTACCCAAGTA
                      ____________________________________________________________
consensus TGAATGGACAGAAGTATAGTCTAACTTTAGTGAAACTACAATTTCATATGTACCCAAGTA
 
. : . : . : . : . : . :
rJMSF044P08+ ATGTTCTTTACTCACTTCAATAGGATTTATATACGGAGTACTAATTTTTTCATCATGAAG
rJMFF014O02+ ATGTTCTTTACTCACTTCAATAGGATTTATATACGGAGTACTAATTTTTTCATCATGAAG
                      ____________________________________________________________
consensus ATGTTCTTTACTCACTTCAATAGGATTTATATACGGAGTACTAATTTTTTCATCATGAAG
 
. : . : . : . : . : . :
rJMSF044P08+ CCAATATTAAATTCAGTAGTACAGCAGCCAAATTGTATGTATGGATTCATAATTCTTTCC
rJMFF014O02+ CCAATATTAAATTCAGTAGTACAGCAGCCAAATTGTATGTATGGATTCATAATTCTTTCC
                      ____________________________________________________________
consensus CCAATATTAAATTCAGTAGTACAGCAGCCAAATTGTATGTATGGATTCATAATTCTTTCC
 
. : . : . : . : . : . :
rJMSF044P08+ TGGCTTTTTCTTGTGCTAAAGTTGTATTATGCACACAAC
rJMFF014O02+ TGGCTTTTTCTTGTGCTAAAGTTGTATTATGCACACAACTTTCACTGCTTACAAAACATA
                      ____________________________________________________________
consensus TGGCTTTTTCTTGTGCTAAAGTTGTATTATGCACACAACTTTCACTGCTTACAAAACATA