Previous Contig 008895:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014N11Sequence541000763 (7)pir|T52451|T524515e-21endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido758008895 (7)pir|T52451|T524514e-54endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido
JMFF034E04Sequence525000763 (7)pir|T52451|T524516e-27endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido707008895 (7)pir|T52451|T524513e-50endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido
JMSF004L14Sequence402004638 (5)sp|Q8LA14|PSK6_ARATH2e-09Putative phytosulfokines 6 precursor (AtPSK6) (AtPSK3_2) [Contains: Phytosulfoki277008895 (7)
JMSF004N16Sequence237000763 (7)314008895 (7)
JMSF005G10Sequence392008895 (7)pir|T52451|T524514e-07endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido
JMSF008D08Sequence304000763 (7)794008895 (7)pir|T52451|T524513e-63endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido
JMSF025L19Sequence361004367 (7)763008895 (7)pir|T52451|T524512e-67endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025L19+ CAGCCGTTAGTGAGCTTCTTGTTGCTCAATTTTTGTGGTTGGATTATGA
rJMSF008D08+ TACCAGCCGTTAGTGAGCTTCTTGTTGCTCAATTTTTGTGGTTGGATTATGA
                      ____________________________________________________________
consensus TACCAGCCGTTAGTGAGCTTCTTGTTGCTCAATTTTTGTGGTTGGATTATGA
 
. : . : . : . : . : . :
rJMSF025L19+ TAATCC-TTCAAAGCCTATATATCTCTACATAAATTCACATGGCACCCAGAATGAGAGGA
rJMSF008D08+ TAATCCTTTCAAAGCCTATATATCTCTACATAAATTCACATGGCACCCAGAATGAGAGGA
rJMFF034E04+ CAGAATGAGAGGA
rJMFF014N11+ TCTCTACATAAATTCACATGGCACCCAGAATGAGAGGA
                      ____________________________________________________________
consensus TAATCCTTTCAAAGCCTATATATCTCTACATAAATTCACATGGCACCCAGAATGAGAGGA
 
. : . : . : . : . : . :
rJMSF025L19+ GGGAGTTGGTTGGTTCTGAAACAGATGCATACGCCATTGCTGATGCCATGCGTTTAAGCA
rJMSF008D08+ GGGAGTTGGTTGGTTCTGAAACAGATGCATACGCCATTGCTGATGCCATGCGTTTAAGCA
rJMFF034E04+ GGGAGTTGGTTGGTTCTGAAACAGATGCATACGCCATTGCTGATGCCATGCGTTTAAGCA
rJMFF014N11+ GGGAGTTGGTTGGTTCTGAAACAGATGCATACGCCATTGCTGATGCCATGCGTTTAAGCA
                      ____________________________________________________________
consensus GGGAGTTGGTTGGTTCTGAAACAGATGCATACGCCATTGCTGATGCCATGCGTTTAAGCA
 
. : . : . : . : . : . :
rJMSF025L19+ AACCAGATGTTTGTACAGTGAATGTTGGTAAGGCATATGGTCAAGCAGGAATGCTTCTGT
rJMSF008D08+ AACCAGATGTTTGTACAGTGAATGTTGGTAAGGCATATGGTCAAGCAGGAATGCTTCTGT
rJMFF034E04+ AACCAGATGTTTGTACAGTGAATGTTGGTAAGGCATATGGTCAAGCAGGAATGCTTCTGT
rJMFF014N11+ AACCAGATGTTTGTACAGTGAATGTTGGTAAGGCATATGGTCAAGCAGGAATGCTTCTGT
                      ____________________________________________________________
consensus AACCAGATGTTTGTACAGTGAATGTTGGTAAGGCATATGGTCAAGCAGGAATGCTTCTGT
 
. : . : . : . : . : . :
rJMSF025L19+ CACTTGGGAAGAAAGGCTTCCGAGCTTTACAAGCAAGTGCATCCACAAAATTATATCTAC
rJMSF008D08+ CACTTGGGAAGAAAGGCTTCCGAGCTTTACAAGCAAGTGCATCCACAAAATTATATCTAC
rJMFF034E04+ CACTTGGGAAGAAAGGCTTCCGAGCTTTACAAGCAAGTGCATCCACAAAATTATATCTAC
rJMFF014N11+ CACTTGGGAAGAAAGGCTTCCGAGCTTTACAAGCAAGTGCATCCACAAAATTATATCTAC
                      ____________________________________________________________
consensus CACTTGGGAAGAAAGGCTTCCGAGCTTTACAAGCAAGTGCATCCACAAAATTATATCTAC
 
. : . : . : . : . : . :
rJMSF025L19+ CTGATGTTTACAAATCAAGTGGACCTGTGACTGAAATGTGGATTAAGGCAAAAGAGCTTG
rJMSF008D08+ CTGATGTTTACAAATCAAGTGGACCTGTGACTGAAATGTGGATTAAGGCAAAAGAGCTTG
rJMFF034E04+ CTGATGTTTACAAATCAAGTGGACCTGTGACTGAAATGTGGATTAAGGCAAAAGAGCTTG
rJMFF014N11+ CTGATGTTTACAAATCAAGTGGACCTGTGACTGAAATGTGGATTAAGGCAAAAGAGCTTG
                      ____________________________________________________________
consensus CTGATGTTTACAAATCAAGTGGACCTGTGACTGAAATGTGGATTAAGGCAAAAGAGCTTG
 
. : . : . : . : . : . :
rJMSF025L19+ ATGCAAACAAAGACTATTACCTCGAGCTATTGTCCAAAGGGATTGGTAAACCAAAGGAAG
rJMSF008D08+ ATGCAAACAAGGACTATTACCTCGAGCTATTGTCCAAAGGGATTGGTAAACCAAAGGAAG
rJMFF034E04+ ATGCAAACAAAGACTATTACCTCGAGCTATTGTCCAAAGGGATTGGTAAACCAAAGGAAG
rJMFF014N11+ ATGCAAACAAAGACTATTACCTCGAGCTATTGTCCAAAGGGATTGGTAAACCAAAGGAAG
                      ____________________________________________________________
consensus ATGCAAACAAAGACTATTACCTCGAGCTATTGTCCAAAGGGATTGGTAAACCAAAGGAAG
 
. : . : . : . : . : . :
rJMSF025L19+ AAATTGAGAGAGATATTCAACGTCCTCAATATTTCACAGTACAAGAGGCCATTGACTATG
rJMSF008D08+ AAATTGAGAGAGATATTCAACGTCCTCAATATTTCACAGTACAAGAGGCCATTGACTATG
rJMFF034E04+ AAATTGAGAGAGATATTCAACGTCCTCAATATTTCACAGTACAAGAGGCCATTGACTATG
rJMSF005G10+ TTGAGAGAGATNTTCAACGTCCTCAATATTTCACAGTACAAGAGGCCATCGACTATG
rJMFF014N11+ AAATTGAGAGAGATATTCAACGTCCTCAATATTTCACAGTACAAGAGGCCATTGACTATG
                      ____________________________________________________________
consensus AAATTGAGAGAGATATTCAACGTCCTCAATATTTCACAGTACAAGAGGCCATTGACTATG
 
. : . : . : . : . : . :
rJMSF025L19+ GCATTGCAGACAAGATTATTGATCCAAAAGATTCTATATTTGAGAAGCGGGATTACGAAG
rJMSF008D08+ GCATTGCAGACAAGATTATTGATCCAAAAGATTCTATATTTGAGAAGCGGGATTACGAAG
rJMFF034E04+ GCATTGCAGACAAGATTATTGATCCAAAAGATTCTATATTTGAGAAGCGGGATTACGAAG
rJMSF005G10+ GCATTGCAGACAAGATTATTGATCCAAAAGATTCTATATTTGNGAAGCGGGATTACGAAG
rJMSF004N16+ CAAGATTANTGATCCAAAAGATTCTATA-TTGAGAAGCGGGATTACGAAG
rJMSF004L14+ GAAG
rJMFF014N11+ GCATTGCAGACAAGATTATTGATCCAAAAGATTCTATATTTGAGAAGCGGGATTACGAAG
                      ____________________________________________________________
consensus GCATTGCAGACAAGATTATTGATCCAAAAGATTCTATATTTGAGAAGCGGGATTACGAAG
 
. : . : . : . : . : . :
rJMSF025L19+ GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
rJMSF008D08+ GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
rJMFF034E04+ GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
rJMSF005G10+ GCATGCTTGCCCANTCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTN
rJMSF004N16+ GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
rJMSF004L14+ GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
rJMFF014N11+ GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
                      ____________________________________________________________
consensus GCATGCTTGCCCAATCAAGAGCAATGAGGAGAGCAGCTGGATCAGGTGCACAAGCGGCTG
 
. : . : . : . : . : . :
rJMSF025L19+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
rJMSF008D08+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
rJMFF034E04+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
rJMSF005G10+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
rJMSF004N16+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
rJMSF004L14+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
rJMFF014N11+ CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
                      ____________________________________________________________
consensus CTGGCTCTGGGTTTAGGTAGGTAACTCATGGTGTCCAAATTTGAAGAATGAAAACTTCTG
 
. : . : . : . : . : . :
rJMSF025L19+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
rJMSF008D08+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
rJMFF034E04+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
rJMSF005G10+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
rJMSF004N16+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
rJMSF004L14+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
rJMFF014N11+ GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
                      ____________________________________________________________
consensus GTTACCTTTGAAATCTGGTCTTTCAAGTATCTGGTGTAGAGGCAGGCACTTTCCAATTGT
 
. : . : . : . : . : . :
rJMSF025L19+ ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATAC
rJMSF008D08+ ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
rJMFF034E04+ ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
rJMSF005G10+ ACTGTGTTACAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
rJMSF004N16+ ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
rJMSF004L14+ ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
rJMFF014N11+ ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
                      ____________________________________________________________
consensus ACTGTGTTAAAATTTCTGTAATCACCAGTTCACAAGTTTAGTAGTGCCATGATACTTATA
 
. : . : . : . : . : . :
rJMSF008D08+ CAAGAT
rJMFF034E04+ CAAGATTGTACTTAAAAAAAGTATTGTTAATTG
rJMSF005G10+ CAAGATTGTACTTAAAAAAAGTATTGTTAATTG
rJMSF004N16+ CAAGATTGTACTTAAAAAAAGTATT
rJMSF004L14+ CAAGATTGTACTTAAAAAAAGTATTGTTAATTG
rJMFF014N11+ CAAGATTGTACTTAAAAAAAGTATTGTTAATTGATGTCCACAGCTACTTTGCTTTGCTAT
                      ____________________________________________________________
consensus CAAGATTGTACTTAAAAAAAGTATTGTTAATTGATGTCCACAGCTACTTTGCTTTGCTAT