Previous Contig 008894:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014N03Sequence554004775 (4)727008894 (5)gb:AY050459_15622331e-29Arabidopsis thaliana AT4g36870/C7A10_490 mRNA, complete cds.>gb:AF173816_1774456
JMFF024E13Sequence433004775 (4)688008894 (5)gb:AY050459_15622332e-24Arabidopsis thaliana AT4g36870/C7A10_490 mRNA, complete cds.>gb:AF173816_1774456
JMSF005F08Sequence400008894 (5)
JMSF006C02Sequence177004775 (4)359008894 (5)
JMSF018M06Sequence197004775 (4)756008894 (5)gb:AF406699_17969077e-37Solanum tuberosum BEL1-related homeotic protein 13 (Bel13) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018M06+ CGTTGCAGGGAGTTA
                      ____________________________________________________________
consensus CGTTGCAGGGAGTTA
 
. : . : . : . : . : . :
rJMSF018M06+ TGGGTTGACGAAAGGGGAAACGCCGAGGCTGAAACTGCTAGACCAGAAGCTGAGGCAACA
                      ____________________________________________________________
consensus TGGGTTGACGAAAGGGGAAACGCCGAGGCTGAAACTGCTAGACCAGAAGCTGAGGCAACA
 
. : . : . : . : . : . :
rJMSF018M06+ GAAAGGTGCTTTGAACCAGATGGGAATGCTTCTGGACTCTGAGCCATGGCGGCCGCAAAG
rJMFF014N03+ GCCGCAAAG
                      ____________________________________________________________
consensus GAAAGGTGCTTTGAACCAGATGGGAATGCTTCTGGACTCTGAGCCATGGCGGCCGCAAAG
 
. : . : . : . : . : . :
rJMSF018M06+ AGGGCTGCCGGACCGGTCCGTTAACGTCCTGAGATCGTGGCTTTTCGAGCATTTTCTTAA
rJMFF024E13+ GTTAACGTCCTGAGATCGTGGCTTTTCGAGCATTTTCTTAA
rJMFF014N03+ AGGGCTGCCGGACCGGTCNGTTAACGTCCTGAGATCGTGGCTTTTCGAGCATTTTCTTAA
                      ____________________________________________________________
consensus AGGGCTGCCGGACCGGTCCGTTAACGTCCTGAGATCGTGGCTTTTCGAGCATTTTCTTAA
 
. : . : . : . : . : . :
rJMSF018M06+ CCCGTATCCGAGTGAAGCAGACAAGGTTTTGTTGTCTCGCCAAACTGGTCTGTCCAAAAA
rJMFF024E13+ CCCGTATCCGAGTGAAGCAGACAAGGTTTTGTTGTCTCGCCAAACTGGTCTGTCCAAAAA
rJMFF014N03+ CCCGTATCCGAGTGAAGCAGACAAGGTTTTGTTGTCTCGCCAAACTGGTCTGTCCAAAAA
                      ____________________________________________________________
consensus CCCGTATCCGAGTGAAGCAGACAAGGTTTTGTTGTCTCGCCAAACTGGTCTGTCCAAAAA
 
. : . : . : . : . : . :
rJMSF018M06+ TCAGGTTTCAAATTGGTTTATTAATGCTAGGGTAAGGCTGTGGAAACCCATGGTGGAAGA
rJMFF024E13+ TCAGGTTTCAAATTGGTTTATTAATGCTAGGGTAAGGCTGTGGAAACCCATGGTGGAAGA
rJMFF014N03+ TCAGGTTTCAAATTGGTTTATTAATGCTAGGGTAAGGCTGTGGAAACCCATGGTGGAAGA
                      ____________________________________________________________
consensus TCAGGTTTCAAATTGGTTTATTAATGCTAGGGTAAGGCTGTGGAAACCCATGGTGGAAGA
 
. : . : . : . : . : . :
rJMSF018M06+ AATGTACGAACAAGAAACTAAAGAAGAAGAAAACGCACAGACACCGATGCCGCGTGACGA
rJMFF024E13+ AATGTACGAACAAGAAACTAAAGAAGAAGAAAACGCACAGACACCGATGCCGCGTGACGA
rJMFF014N03+ AATGTACGAACAAGAAACTAAAGAAGAAGAAAACGCACAGACACCGATGCCGCGTGACGA
                      ____________________________________________________________
consensus AATGTACGAACAAGAAACTAAAGAAGAAGAAAACGCACAGACACCGATGCCGCGTGACGA
 
. : . : . : . : . : . :
rJMSF018M06+ CGATGATGATAATAGTAAGGAAATTACTGCGACAACATCGACTACGCCGACGACGACAAC
rJMFF024E13+ CGATGATGATAATAGTAAGGAAATTACTGCGACAACATCGACTACGCCGACGACGACAAC
rJMSF005F08+ GACGACGACAAC
rJMFF014N03+ CGATGATGATAATAGTAAGGAAATTACTGCGACAACATCGACTACGCCGACGACGACAAC
                      ____________________________________________________________
consensus CGATGATGATAATAGTAAGGAAATTACTGCGACAACATCGACTACGCCGACGACGACAAC
 
. : . : . : . : . : . :
rJMSF018M06+ AACGTTACCGTCGGCTGCAGCGACAAAAAGATGCCAATTCAATGCCACGGAAAACGACTC
rJMFF024E13+ AACGTTACCGTCGGCTGCAGCGACAAAAAGATGCCAATTCAATGCCACGGAAAACGACTC
rJMSF005F08+ AACGTNACCGTCGGNTGCAGCGACAAAAAGATGCCAATTCAATGCCACGGAAAACGACTC
rJMSF006C02+ TGCCACGGAAAACGACTC
rJMFF014N03+ AACGTTACCGTCGGCTGCAGCGACAAAAAGATGCCAATTCAATGCCACGGAAAACGACTC
                      ____________________________________________________________
consensus AACGTTACCGTCGGCTGCAGCGACAAAAAGATGCCAATTCAATGCCACGGAAAACGACTC
 
. : . : . : . : . : . :
rJMSF018M06+ CTCACGAACTAACATCATCAATAATTATGCAGCCCAGTACGCCGCCTCGGGAAACCAAGT
rJMFF024E13+ CTCACGAACTAACATCATCAATAATTATGCAGCCCAGTACGCCGCCTCGGGAAACCAAGT
rJMSF005F08+ CTCACGAACTAACATCATCAATAATTATGCAGCCCAGTACGCCGCCTCGGGAAACCAAGT
rJMSF006C02+ CTCACGAACTAACATCATCAATAATTATGCAGCCCAGTACGCCGCCTCGGGAAACCAAGT
rJMFF014N03+ CTCACGAACTAACATCATCAATAATTATGCAGCCCAGTACGCCGCCTCGGGAAACCAAGT
                      ____________________________________________________________
consensus CTCACGAACTAACATCATCAATAATTATGCAGCCCAGTACGCCGCCTCGGGAAACCAAGT
 
. : . : . : . : . : . :
rJMSF018M06+ CACGATGATTAATGGTAACACCGCCGCCGTGCCGCCCCCTGTGAGCCTATCTTTCGCGGC
rJMFF024E13+ CACGATGATTAATGGTAACACCGCCGCCGTGCCGCCCCCTGTGAGCCTATCTTTCGCGGC
rJMSF005F08+ CACGATGATTAATGGTAACACCGCCGCCGTGCCGCCCCCTGTGAGCCTATCTTTCGCGGC
rJMSF006C02+ CACGATGATTAATGGTAACACCGCCGCCGTGCCGCCCCNTGTGAGCNTATCTTTCGCGGC
rJMFF014N03+ CACGATGATTAATGGTAACACCGCCGCCGTGCCGCCCCCTGTGAGCCTATCTTTCGCGGC
                      ____________________________________________________________
consensus CACGATGATTAATGGTAACACCGCCGCCGTGCCGCCCCCTGTGAGCCTATCTTTCGCGGC
 
. : . : . : . : . : . :
rJMSF018M06+ AGCGGCGGCTCCGGTGGTGGATTGTGGCGGTGGGTTCGGGACTCCGGCGACAGGTGACGT
rJMFF024E13+ AGCGGCGGCTCCGGTGGTGGATTGTGGCGGTGGGTTCGGGACTCCGGCGACAGGTGACGT
rJMSF005F08+ AGCGGCGGCTCCGGTGGTGGATTGTGGCGGTGGGTTCGGGACTCCGGCGACAGGTGACGT
rJMSF006C02+ AGCGGCGGCTCCGGTGGTGGATTGTGGCGGTGGGTTCGGGACTCCGNCGACAGGTGNCGT
rJMFF014N03+ AGCGGCGGCTCCGGTGGTGGATTGTGGCGGTGGGTTCGGGACTCCGGCGACAGGTGACGT
                      ____________________________________________________________
consensus AGCGGCGGCTCCGGTGGTGGATTGTGGCGGTGGGTTCGGGACTCCGGCGACAGGTGACGT
 
. : . : . : . : . : . :
rJMSF018M06+ GTCCCTAACTTTGGGACTTCGGCACCCAGAAAATAGTGTAACTATTACAAACTTTGGGGC
rJMFF024E13+ GTCCCTAACTTTGGGACTTCGGCACCCAGAAAATAGTGTAACTATTACAAACTTTGGGGC
rJMSF005F08+ GTCCCTAACTTTGGGACTTCGGCACCCAGAAAATAGTGTAACTATTACAAACTTTGGGGC
rJMSF006C02+ GTCCCTAACTTTGGGNNTTNGGCACCCAGAAAATAGTGTAANTATTACAAACTTTGGGGC
rJMFF014N03+ GTCCCTAACTTTGGGACTTCGGCACCCAGAAAATAGTGTAACTATTACAAACTTTGGGGC
                      ____________________________________________________________
consensus GTCCCTAACTTTGGGACTTCGGCACCCAGAAAATAGTGTAACTATTACAAACTTTGGGGC
 
. : . : . : . : . : . :
rJMSF018M06+ CTATTAAATATATTTT-TA-GTA
rJMFF024E13+ CTATTAAATATATTTT-TA-GTACTAAAACACAAAATGGCTACAAAAATTATATATATAT
rJMSF005F08+ CTATTAAATATATTTT-TA-GTACTAAAACACAAAATGGCTACAAAAATTATATATATAT
rJMSF006C02+ CTGTTAAATATATTTTGTATGTACTAAAACACAAAATGGCTACAAAAATNATATNTATAT
rJMFF014N03+ CTATTAAATATATTTT-TA-GTACTAAAACACAAAATGGCTACAAAAATTATATATATAT
                      ____________________________________________________________
consensus CTATTAAATATATTTT-TA-GTACTAAAACACAAAATGGCTACAAAAATTATATATATAT
 
. : . : . : . : . : . :
rJMFF024E13+ ATAATTCGTGAATAATTTGGGTTTTGTAATTGACATATAAC
rJMSF005F08+ ATAATTCGTGAATAATTTGGGTTTTGTAAT
rJMSF006C02+ ATAATTCGTGAATAATTTGGGTTTTGTAATTGACATATAAC
rJMFF014N03+ ATAATTCGTGAATAATTTGGGTTTTGTAATTGACATATAACTCTTAGTGTAAAATTAAAG
                      ____________________________________________________________
consensus ATAATTCGTGAATAATTTGGGTTTTGTAATTGACATATAACTCTTAGTGTAAAATTAAAG