Previous Contig 008875:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014H20Sequence550001025 (2)gb:AY081548_15688086e-11Arabidopsis thaliana unknown protein (Z97339.45) mRNA, complete cds.>gb:AF386934762008875 (2)gb:AP002870_18235035e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMFF020F18Sequence525001025 (2)gb:AY081548_15688081e-07Arabidopsis thaliana unknown protein (Z97339.45) mRNA, complete cds.>gb:AF386934716008875 (2)gb:AK117529_18155602e-44Arabidopsis thaliana At3g06910 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020F18+ ATGTGACAAAATTTTNGTC
rJMFF014H20+ AAATTAGGATACTGCCTATTTGAATGTGACAAAATTTTNGTC
                      ____________________________________________________________
consensus AAATTAGGATACTGCCTATTTGAATGTGACAAAATTTTNGTC
 
. : . : . : . : . : . :
rJMFF020F18+ CCCATTCACAAAGAAATACATTGGTGTTTAGCTGTCATCAACAAGAAGGATGAAAAGTTC
rJMFF014H20+ CCCATTCACAAAGAAATACATTGGTGTTTAGCTGTCATCAACAAGAAGGATGAAAAGTTC
                      ____________________________________________________________
consensus CCCATTCACAAAGAAATACATTGGTGTTTAGCTGTCATCAACAAGAAGGATGAAAAGTTC
 
. : . : . : . : . : . :
rJMFF020F18+ CAGTATCTTGATTCTCTAAGGGGAAGAGATTCTAAAGTTCTGAAAGCATTGGCTAGGTAC
rJMFF014H20+ CAGTATCTTGATTCTCTAAGGGGAAGAGATTCTAAAGTTCTGAAAGCATTGGCTAGGTAC
                      ____________________________________________________________
consensus CAGTATCTTGATTCTCTAAGGGGAAGAGATTCTAAAGTTCTGAAAGCATTGGCTAGGTAC
 
. : . : . : . : . : . :
rJMFF020F18+ TATGCTGATGAAGTGAAGGACAAGAGTGGTGAAGCCATTGATGTTAGTTCATGGGAACAA
rJMFF014H20+ TATGCTGATGAAGTGAAGGACAAGAGTGGTGAAGCCATTGATGTTAGTTCATGGGAACAA
                      ____________________________________________________________
consensus TATGCTGATGAAGTGAAGGACAAGAGTGGTGAAGCCATTGATGTTAGTTCATGGGAACAA
 
. : . : . : . : . : . :
rJMFF020F18+ GAATTTGTTGAAGACCTTCCTGAGCAAGAAAATGGGTTTGACTGTGGAATGTTCATGATT
rJMFF014H20+ GAATTTGTTGAAGACCTTCCTGAGCAAGAAAATGGGTTTGACTGTGGAATGTTCATGATT
                      ____________________________________________________________
consensus GAATTTGTTGAAGACCTTCCTGAGCAAGAAAATGGGTTTGACTGTGGAATGTTCATGATT
 
. : . : . : . : . : . :
rJMFF020F18+ AAGTATGCTGATTTCTACAGCAGAAATATAGGGCTCTGTTTTAACCAGGAACACATGCAG
rJMFF014H20+ AAGTATGCTGATTTCTACAGCAGAAATATAGGGCTCTGTTTTAACCAGGAACACATGCAG
                      ____________________________________________________________
consensus AAGTATGCTGATTTCTACAGCAGAAATATAGGGCTCTGTTTTAACCAGGAACACATGCAG
 
. : . : . : . : . : . :
rJMFF020F18+ TATTTTCGGTTGAGGACTGCAAAGGAGA-TTTGAGGTTGAAAGCAGACTGATCAAGCTTG
rJMFF014H20+ TATTTTCGGTTGAGGACTGCAAAGGAGATTTTGAGGTTGAAAGCAGACTGATCAAGCTTG
                      ____________________________________________________________
consensus TATTTTCGGTTGAGGACTGCAAAGGAGATTTTGAGGTTGAAAGCAGACTGATCAAGCTTG
 
. : . : . : . : . : . :
rJMFF020F18+ AACACGCTCTCCCGCGTTCTAATTACCGATAATGAATCTTACAAAACAATCAACAGATAA
rJMFF014H20+ AACACGCTCTCCCGCGTTCTAATTACCGATAATGAATCTTACAAAACAATCAACAGATAA
                      ____________________________________________________________
consensus AACACGCTCTCCCGCGTTCTAATTACCGATAATGAATCTTACAAAACAATCAACAGATAA
 
. : . : . : . : . : . :
rJMFF020F18+ TTGATTAGTGTGCAGATATGATATGATGTTTCTTCTCTCCATTCAAAATTACGCACTATA
rJMFF014H20+ TTGATTAGTGTGCAGATATGATATGATGTTTCTTCTCTCCATTCAAAATTACGCACTATA
                      ____________________________________________________________
consensus TTGATTAGTGTGCAGATATGATATGATGTTTCTTCTCTCCATTCAAAATTACGCACTATA
 
. : . : . : . : . : . :
rJMFF020F18+ GCTCTAGCCAGTGGATGCCAGTTTTGCAGTTACTTTCGATTGAGTGAGGTGTATTGTTTT
rJMFF014H20+ GCTCTAGCCAGTGGATGCCAGTTTTGCAGTTACTTTCGATTGAGTGAGGTGTATTGTTTT
                      ____________________________________________________________
consensus GCTCTAGCCAGTGGATGCCAGTTTTGCAGTTACTTTCGATTGAGTGAGGTGTATTGTTTT
 
. : . : . : . : . : . :
rJMFF020F18+ GTTTGTAAAAACCTGGTAAGCCATGGTTTGTCCTTGTACATGAATTTCTAGGGATCCTAT
rJMFF014H20+ GTTTGTAAAAACCTGGTAAGCCATGGTTTGTCCTTGTACATGAATTTCTAGGGATCCTAT
                      ____________________________________________________________
consensus GTTTGTAAAAACCTGGTAAGCCATGGTTTGTCCTTGTACATGAATTTCTAGGGATCCTAT
 
. : . : . : . : . : . :
rJMFF020F18+ CCAAGTGTTGATGGTTAGCTTTTTCTTCCTACAGAATTTTGACCTCTATTTAGGCACAAG
rJMFF014H20+ CCAAGTGTTGATGGTTAGCTTTTTCTTCCTACAGAATTTTGACCTCTATTTAGGCACAAG
                      ____________________________________________________________
consensus CCAAGTGTTGATGGTTAGCTTTTTCTTCCTACAGAATTTTGACCTCTATTTAGGCACAAG
 
. : . : . : . : . : . :
rJMFF020F18+ TCTATATGCCTTGTGAAGATTAAATCTGATTGCTGCTT
rJMFF014H20+ TCTATATGCCTTGTGAAGATTAAATCTGATTGCTGCTTTGTCCTTAGTTTTCTGAGTAAA
                      ____________________________________________________________
consensus TCTATATGCCTTGTGAAGATTAAATCTGATTGCTGCTTTGTCCTTAGTTTTCTGAGTAAA