Previous Contig 008867:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014F19Sequence740008867 (4)pir|C85438|C854381e-47hypothetical protein AT4g37100 [imported] - Arabidopsis thaliana>gb:ATAP21_15439
JMSF008K04Sequence332005016 (2)809008867 (4)gb:AB026640_15170941e-59Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K8A10.
JMSF015G06Sequence196005016 (2)787008867 (4)gb:AB026640_15170942e-60Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K8A10.
JMSF028H07Sequence798008867 (4)gb:AB026640_15170942e-53Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K8A10.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015G06+ ATCAGACAGGAGAGAACCCGAGATAATATGC
rJMSF028H07+ ATCAGACAGGAGAGAACCCGAGATAATATGC
rJMSF008K04+ ATATGATGGGCCAGNATCAGACAGGAGAGANCCCGAGATAATATGC
                      ____________________________________________________________
consensus ATATGATGGGCCAGNATCAGACAGGAGAGAACCCGAGATAATATGC
 
. : . : . : . : . : . :
rJMSF015G06+ AAGCATCTGGATCATATAAACATGTTGGGTCTCAACAAGACTACTTTTCGATTACGGTAT
rJMSF028H07+ AAGCATCTGGATCATATAAACATGTTGGGTCTCANCANGACTACTTTTCGATTACGGTAT
rJMSF008K04+ AAGCATCTGGATCATATAAACATGTTGGGTCTCAACAAGACTACTTTTCGATTACGGTAT
rJMFF014F19+ CTACTTTTCGATTACGGTAT
                      ____________________________________________________________
consensus AAGCATCTGGATCATATAAACATGTTGGGTCTCAACAAGACTACTTTTCGATTACGGTAT
 
. : . : . : . : . : . :
rJMSF015G06+ CTCGTTAATTGGCTCGTGACCTCGTTGCTGCAATTAAGACTGCCCGGTTCAAACGGAGAG
rJMSF028H07+ CTCGTTAATTGGCTCGTGACCTCGTTGCTGCAATTAAGACTGCCCGGTTCAAACGGAGAG
rJMSF008K04+ CTCGTTAATTGGCTCGTGACCTCGTTGCTGCAATTAAGACTGCCCGGTTCAAACGGAGAG
rJMFF014F19+ CTCGTTAATTGGCTCGTGACCTCGTTGCTGCAATTAAGACTGCCCGGTTCAAACGGAGAG
                      ____________________________________________________________
consensus CTCGTTAATTGGCTCGTGACCTCGTTGCTGCAATTAAGACTGCCCGGTTCAAACGGAGAG
 
. : . : . : . : . : . :
rJMSF015G06+ AACAGTGTATCACTTGTTCACATCTATGGACCCAAAATAAAATACGAGAGAGGTGCAGCT
rJMSF028H07+ AACAGTGTATCACTTGTTCACATCTATGGACCCAAAATAAAAT-CGAGAGAGGTGCAGCT
rJMSF008K04+ AACAGTGTATCACTTGTTCACATCTATGGACCCAAAATAAAATACGAGAGAGGTGCAGCT
rJMFF014F19+ AACAGTGTATCACTTGTTCACATCTATGGACCCAAAATAAAATACGAGAGAGGTGCAGCT
                      ____________________________________________________________
consensus AACAGTGTATCACTTGTTCACATCTATGGACCCAAAATAAAATACGAGAGAGGTGCAGCT
 
. : . : . : . : . : . :
rJMSF015G06+ GTTGCTTTCAATGTGAGAAACAGCAATCGGGGTCTTATAAGACCAGAAGTTGTGCAGAAA
rJMSF028H07+ GTTGCTTTCAATGTGAGAAACAGCAATCGGGGTCTTATAAGACCAGAAGTTGTGCAGAAA
rJMSF008K04+ GTTGCTTTCAATGTGAGAAACAGCAATCGGGGTCTTATAAGACCAGAAGTTGTGCAGAAA
rJMFF014F19+ GTTGCTTTCAATGTGAGAAACAGCAATCGGGGTCTTATAAGACCAGAAGTTGTGCAGAAA
                      ____________________________________________________________
consensus GTTGCTTTCAATGTGAGAAACAGCAATCGGGGTCTTATAAGACCAGAAGTTGTGCAGAAA
 
. : . : . : . : . : . :
rJMSF015G06+ CTGGCCGATATGCACGGTATTTATCTCGGCATTGGCATCCTCAGTCACATTCGGATTCTC
rJMSF028H07+ CTGGCCGATATGCACGGTATTTATCTCGGCATTGGCATCCTCAGTCACATTCGGATTCTC
rJMSF008K04+ CTGGCCGATATGCACGGTATTTATCTCGGCATTGGCATCCTCAGTCACATTCGGATTCTC
rJMFF014F19+ CTGGCCGATATGCACGGTATTTATCTCGGCATTGGCATCCTCAGTCACATTCGGATTCTC
                      ____________________________________________________________
consensus CTGGCCGATATGCACGGTATTTATCTCGGCATTGGCATCCTCAGTCACATTCGGATTCTC
 
. : . : . : . : . : . :
rJMSF015G06+ GATAGTTCAAAACAGCAGCGTGGAGCTTCAAATCTCGAAGTCACAATGGACAATGGCAGG
rJMSF028H07+ GATAGTTCAAAACAGCAGCGTGGAGCTTCAAATCTCGAAGTCACAATGGACAATGGCAGG
rJMSF008K04+ GATAGTTCAAAACAGCAGCGTGGAGCTTCAAATCTCGAAGTCACAATGGACAATGGCAGG
rJMFF014F19+ GATAGTTCAAAACAGCAGCGTGGAGCTTCAAATCTCGAAGTCACAATGGACAATGGCAGG
                      ____________________________________________________________
consensus GATAGTTCAAAACAGCAGCGTGGAGCTTCAAATCTCGAAGTCACAATGGACAATGGCAGG
 
. : . : . : . : . : . :
rJMSF015G06+ CACGACGCTAAAAGTGGGTTCATCAGAGTCGAGGTCCTCACTGCATCACTCGGCTTCCTT
rJMSF028H07+ CACGACGCTAAAAGTGGGTTCATCAGAGTCGAGGTCCTCACTGCATCACTCGGCTTCCTT
rJMSF008K04+ CACGACGCTAAAAGTGGGTTCATCAGAGTCGAGGTCCTCACTGCATCACTCGGCTTCCTT
rJMFF014F19+ CACGACGCTAAAAGTGGGTTCATCAGAGTCGAGGTCCTCACTGCATCACTCGGCTTCCTT
                      ____________________________________________________________
consensus CACGACGCTAAAAGTGGGTTCATCAGAGTCGAGGTCCTCACTGCATCACTCGGCTTCCTT
 
. : . : . : . : . : . :
rJMSF015G06+ TCTAACTTCGAAGACGTGTACCAATTGTGGGCTTTCGTGGCTAAATTCCTCAACCCAGAC
rJMSF028H07+ TCTAACTTCGAAGACGTGTACCAATTGTGGGCTTTCGTGGCTAAATTCCTCAACCCAGAC
rJMSF008K04+ TCTAACTTCGAAGACGTGTACCAATTGTGGGCTTTCGTGGCTAAATTCCTCAACCCAGAC
rJMFF014F19+ TCTAACTTCGAAGACGTGTACCAATTGTGGGCTTTCGTGGCTAAATTCCTCAACCCAGAC
                      ____________________________________________________________
consensus TCTAACTTCGAAGACGTGTACCAATTGTGGGCTTTCGTGGCTAAATTCCTCAACCCAGAC
 
. : . : . : . : . : . :
rJMSF015G06+ TTCATCAAACAAACTCTCCTCCCTACTGTCGAAGAAGAGGCTGACGCTTGAAACCCCGAA
rJMSF028H07+ TTCATCAAACAAACTCTCCTCCCTACTGTCGAAGAAGAGGCTGACGCTTGAAACCCCGAA
rJMSF008K04+ TTCATCAAACAAACTCTCCTCCCTACTGTCGAAGAAGAGGCTGACGCTTGAAACCCCGAA
rJMFF014F19+ TTCATCAAACAAACTCTCCTCCCTACTGTCGAAGAAGAGGCTGACGCTTGAAACCCCGAA
                      ____________________________________________________________
consensus TTCATCAAACAAACTCTCCTCCCTACTGTCGAAGAAGAGGCTGACGCTTGAAACCCCGAA
 
. : . : . : . : . : . :
rJMSF015G06+ CGCCATTTCAATGCTCGAGCTTTCTTTTGCCGCAGGACAAAGATGCAGAGAAGTGTGTGC
rJMSF028H07+ CGCCATTTCAATGCTCGAGCTTTCTTTTGCCGCAGGACAAAGATGCAGAGAAGTGTGTGC
rJMSF008K04+ CGCCATTTCAATGCTCGAGCTTTCTTTTGCCGCAGGACAAAGATGCAGAGAAGTGTGTGC
rJMFF014F19+ CGCCATTTCAATGCTCGAGCTTTCTTTTGCCGCAGGACAAAGATGCAGAGAAGTGTGTGC
                      ____________________________________________________________
consensus CGCCATTTCAATGCTCGAGCTTTCTTTTGCCGCAGGACAAAGATGCAGAGAAGTGTGTGC
 
. : . : . : . : . : . :
rJMSF015G06+ TGCCTGGCAAGATTCAAGGTGGATTCTTTAGCAGCACCCTCTGCCTCTTTGATGCATTTT
rJMSF028H07+ TGCCTGGCAAGATTCAAGGTGGATTCTTTAGCAGCACCCTCTGCCTCTTTGATGCATTTT
rJMSF008K04+ TGCCTGGCAAGATTCAAGGTGGATTCTTTAGCAGCACCCTCTGCCTCTTTGATGCATTTT
rJMFF014F19+ TGCCTGGCAAGATTCAAGGTGGATTCTTTAGCAGCACCCTCTGCCTCTTTGATGCATTTT
                      ____________________________________________________________
consensus TGCCTGGCAAGATTCAAGGTGGATTCTTTAGCAGCACCCTCTGCCTCTTTGATGCATTTT
 
. : . : . : . : . : . :
rJMSF015G06+ AGGATAATTTGTTGATTCTTGTTTTGGTTTCTGATTTTCAGCTTTAATTTTGGGATTCTG
rJMSF028H07+ AGGATAATTTGTTGATTCTTGTTTTGGTTTCTGATTTTCAGCTTTAATTTTGGGATTCTG
rJMSF008K04+ AGGATAATTTGTTGATTCTTGTTTTGGTTTCTGATTTTCAGCTTTAATTTTGGGATTCTG
rJMFF014F19+ AGGATAATTTGTTGATTCTTGTTTTGGTTTCTGATTTTCAGCTTTAATTTTGGGATTCTG
                      ____________________________________________________________
consensus AGGATAATTTGTTGATTCTTGTTTTGGTTTCTGATTTTCAGCTTTAATTTTGGGATTCTG
 
. : . : . : . : . : . :
rJMSF015G06+ ATGTGGAGTTGGATTTAGGAATTTGTATATCTTT
rJMSF028H07+ ATGTGGAGTTGGATTTAGGAATTTGTATATCTTT
rJMSF008K04+ ATGTGGAGTTGGATTTAGGAATTTGTATATCTTTAG
rJMFF014F19+ ATGTGGAGTTGGATTTAGGAATTTGTATATCTTTAGGTAGTCATGACGAACTAAAGCATA
                      ____________________________________________________________
consensus ATGTGGAGTTGGATTTAGGAATTTGTATATCTTTAGGTAGTCATGACGAACTAAAGCATA