Previous Contig 008864:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014E10Sequence529008864 (2)sp|Q41350|OLP1_LYCES9e-60Osmotin-like protein precursor.>pir|JC5237|JC5237 osmotin-like protein precursor711008864 (2)sp|Q41350|OLP1_LYCES3e-69Osmotin-like protein precursor.>pir|JC5237|JC5237 osmotin-like protein precursor

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014E10- ATACTTCAATCCTAAAGTCTAAACACCCATTATATTGCCACCACTTCAACTGA
                      ____________________________________________________________
consensus ATACTTCAATCCTAAAGTCTAAACACCCATTATATTGCCACCACTTCAACTGA
 
. : . : . : . : . : . :
JMFF014E10- ACAAATGGCTATGGCTTTTCCAGCCACAATCCTCTCTGTGACTCTCTTCATTTCCCTCTG
                      ____________________________________________________________
consensus ACAAATGGCTATGGCTTTTCCAGCCACAATCCTCTCTGTGACTCTCTTCATTTCCCTCTG
 
. : . : . : . : . : . :
JMFF014E10- CGCCTTCACCACAGCTTCACTACCAGCAGGACTGATTATAACGATAGTGAACAACTGCCC
                      ____________________________________________________________
consensus CGCCTTCACCACAGCTTCACTACCAGCAGGACTGATTATAACGATAGTGAACAACTGCCC
 
. : . : . : . : . : . :
JMFF014E10- TCACACCATCTGGCCAGCAATCCAGCCCAACACCGGCTACCCTGTCCTGGAGCGCGGCGG
                      ____________________________________________________________
consensus TCACACCATCTGGCCAGCAATCCAGCCCAACACCGGCTACCCTGTCCTGGAGCGCGGCGG
 
. : . : . : . : . : . :
JMFF014E10- CTTTGCGCTCTACAAACTCACACACCGCTCTTTCGTGGCTCCTCGCGCCCGCTGGTCTGG
                      ____________________________________________________________
consensus CTTTGCGCTCTACAAACTCACACACCGCTCTTTCGTGGCTCCTCGCGCCCGCTGGTCTGG
 
. : . : . : . : . : . :
JMFF014E10- CCGCATCTGGGCTCGCACCGGTTGCGTCTTGAACCACGGCCGCTTCACTTGCGCCACCGG
                      ____________________________________________________________
consensus CCGCATCTGGGCTCGCACCGGTTGCGTCTTGAACCACGGCCGCTTCACTTGCGCCACCGG
 
. : . : . : . : . : . :
JMFF014E10- GGACTGCGACGGCCGCCTGGAGTGCAACGGGAGAGGCGGGGCGGCCCCGGCAACGCTAGC
rJMFF014E10+ TAGC
                      ____________________________________________________________
consensus GGACTGCGACGGCCGCCTGGAGTGCAACGGGAGAGGCGGGGCGGCCCCGGCAACGCTAGC
 
. : . : . : . : . : . :
JMFF014E10- CCAATTCGAACTCCACCAAGGCCACGCCGACTTCTCAACCTACGGCCTCAGCCTCGTGGA
rJMFF014E10+ CCAATTCGAACTCCACCAAGGCCACGCCGACTTCTCAACCTACGGCCTCAGCCTCGTGGA
                      ____________________________________________________________
consensus CCAATTCGAACTCCACCAAGGCCACGCCGACTTCTCAACCTACGGCCTCAGCCTCGTGGA
 
. : . : . : . : . : . :
JMFF014E10- TGGGTTCAACCTGCCCATGACGCTCACCCCTCACGACGGGAAAGAGCATTGTCCGG
rJMFF014E10+ TGGGTTCAACCTGCCCATGACGCTCACCCCTCACGACGGGAAAGAGCATTGTCCGGTGGT
                      ____________________________________________________________
consensus TGGGTTCAACCTGCCCATGACGCTCACCCCTCACGACGGGAAAGAGCATTGTCCGGTGGT
 
. : . : . : . : . : . :
rJMFF014E10+ GGGGTGTAGGGCCAACCTATTGCCCGCGTGTCCGCGCCAACTCCAGGTCCGTCTGCGGGC
                      ____________________________________________________________
consensus GGGGTGTAGGGCCAACCTATTGCCCGCGTGTCCGCGCCAACTCCAGGTCCGTCTGCGGGC
 
. : . : . : . : . : . :
rJMFF014E10+ TCGCCGCGGCCGTGGGCCGGTAGTGGGGTGCAACAGCGGTTGCGCCGCCTTCAAGACGGA
                      ____________________________________________________________
consensus TCGCCGCGGCCGTGGGCCGGTAGTGGGGTGCAACAGCGGTTGCGCCGCCTTCAAGACGGA
 
. : . : . : . : . : . :
rJMFF014E10+ CGAGCTTTGTTGTCGAAACAATTATAACAACCCGCTAATGTGCAAGGCGTCCAGGTACTC
                      ____________________________________________________________
consensus CGAGCTTTGTTGTCGAAACAATTATAACAACCCGCTAATGTGCAAGGCGTCCAGGTACTC
 
. : . : . : . : . : . :
rJMFF014E10+ GGACTTCTTCAAGCATGCATGTCCCTCTACTTTCACCTACGCCCACGACACCCCGTCATC
                      ____________________________________________________________
consensus GGACTTCTTCAAGCATGCATGTCCCTCTACTTTCACCTACGCCCACGACACCCCGTCATC
 
. : . : . : . : . : . :
rJMFF014E10+ CCTCATGCACGAGTGCTCGGCGGCGCGTGAGCTCAAGATCATTTTCTGCCACTAGGAGTA
                      ____________________________________________________________
consensus CCTCATGCACGAGTGCTCGGCGGCGCGTGAGCTCAAGATCATTTTCTGCCACTAGGAGTA
 
. : . : . : . : . : . :
rJMFF014E10+ CCCATTAACAAGCTAAGGCCTAAGGCAATTGTTTAGTTGCAATGTAATGTCTTCTTGTTT
                      ____________________________________________________________
consensus CCCATTAACAAGCTAAGGCCTAAGGCAATTGTTTAGTTGCAATGTAATGTCTTCTTGTTT
 
. : . : . : . : . : . :
rJMFF014E10+ TTATTTATTTAGTTTTCTTAGCTCTCTGTTTTCATTTATTATTTCTTCTTCTAGGTAATT
                      ____________________________________________________________
consensus TTATTTATTTAGTTTTCTTAGCTCTCTGTTTTCATTTATTATTTCTTCTTCTAGGTAATT
 
. : . : . : . : . : . :
rJMFF014E10+ AAGGGTTCTAACAACACAACACAACACAATATATTGTACGTTGTAATAAATGGGCATATT
                      ____________________________________________________________
consensus AAGGGTTCTAACAACACAACACAACACAATATATTGTACGTTGTAATAAATGGGCATATT