Previous Contig 008863:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014E05Sequence564005624 (6)gb:AY053411_15629242e-65Arabidopsis thaliana At1g31070/F17F8_1 mRNA, complete cds.773008863 (5)gb:AY053411_15629247e-95Arabidopsis thaliana At1g31070/F17F8_1 mRNA, complete cds.
JMFF014H02Sequence554005624 (6)gb:AY088313_15733334e-37Arabidopsis thaliana clone 5509 mRNA, complete sequence.625008863 (5)gb:AY053411_15629245e-83Arabidopsis thaliana At1g31070/F17F8_1 mRNA, complete cds.
JMFN025K02Sequence604008863 (5)sp|O64765|UAP1_ARATH1e-87Probable UDP-N-acetylglucosamine pyrophosphorylase (EC 2.7.7.23).>pir|T00483|T00
JMFN025K04Sequence484008863 (5)sp|O64765|UAP1_ARATH1e-69Probable UDP-N-acetylglucosamine pyrophosphorylase (EC 2.7.7.23).>pir|T00483|T00
JMSF003E04Sequence354005624 (6)gb:AY053411_15629242e-35Arabidopsis thaliana At1g31070/F17F8_1 mRNA, complete cds.737008863 (5)gb:AY053411_15629241e-97Arabidopsis thaliana At1g31070/F17F8_1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025K04- GAAAGTCATAAATA
JMFN025K02- TAGTCCATTCACAGATGAACCAACTCACAAATTTTTTGAAAGTCATAAATA
                      ____________________________________________________________
consensus TAGTCCATTCACAGATGAACCAACTCACAAATTTTTTGAAAGTCATAAATA
 
. : . : . : . : . : . :
JMFN025K04- TTTTGGCCTTGATGAAGATCAAGTTACATTCTTCCAGCAGGGCACAATTCCATGTGTCTC
JMFN025K02- TTTTGGCCTTGATGAAGATCAAGTTACATTCTTCCAGCAGGGCACAATTCCATGTGTCTC
                      ____________________________________________________________
consensus TTTTGGCCTTGATGAAGATCAAGTTACATTCTTCCAGCAGGGCACAATTCCATGTGTCTC
 
. : . : . : . : . : . :
JMFN025K04- AGAGGATGGAAGATTTATAATGGAGACTCCATATAGCGTAACTAAGTCTACTGATGGAAA
JMFN025K02- AAAGGATGGAAGATTTATAATGGAGACTCCATATAGCGTAGCTAAGTCTCCTGATGGAAA
                      ____________________________________________________________
consensus AGAGGATGGAAGATTTATAATGGAGACTCCATATAGCGTAGCTAAGTCTCCTGATGGAAA
 
. : . : . : . : . : . :
JMFN025K04- TGGAGGAGTTTATACAGCATTGAAGTATTCAAAATTATTGGAAGATATGGCAACAAGAGG
JMFN025K02- TGGAGGAGTTTATACAGCATTGAAGTATTCAAAATTATTGGAAGATATGGCAACAAGAGG
                      ____________________________________________________________
consensus TGGAGGAGTTTATACAGCATTGAAGTATTCAAAATTATTGGAAGATATGGCAACAAGAGG
 
. : . : . : . : . : . :
JMFN025K04- CATTAAATATGTAGATTGCTATGGAGTTGACAATGCTTTGGTCCGAGTTGCAGATCCAAC
JMFN025K02- CATTAAATATGTAGATTGCTATGGAGTTGACAATGCTTTGGTCCGAGTTGCAGATCCAAC
                      ____________________________________________________________
consensus CATTAAATATGTAGATTGCTATGGAGTTGACAATGCTTTGGTCCGAGTTGCAGATCCAAC
 
. : . : . : . : . : . :
JMFN025K04- CTTTTTGGGTTATTTCATTGATAAGGGTGTATCTGCTGCAGCAAAAGTTGTAAGAAAGGC
JMFN025K02- CTTTTTGGGTTATTTCATTGATAAGGGTGTATCTGCTGCAGCAAAAGTTGTAAGAAAGGC
rJMSF003E04+ TTGATAAGGGTGTATCTGCTGCAGCAAAAGTTGTAAGAAAGGC
rJMFF014E05+ GGGTTATTTCATTGATAAGGGTGTATCTGCTGCAGCAAAAGTTGTAAGAAAGGC
                      ____________________________________________________________
consensus CTTTTTGGGTTATTTCATTGATAAGGGTGTATCTGCTGCAGCAAAAGTTGTAAGAAAGGC
 
. : . : . : . : . : . :
JMFN025K04- GTACCCACAAGAAAAGGTTGGTGTGTTTGTACGACCAGGTAAAGGTGGGCCTCTCTCTGT
JMFN025K02- ATACCCACAAGAAAAGGTTGGTGTGTTTGTACGACGAGGTAAAGGTGGGCCTCTCTCTGT
rJMSF003E04+ ATACCCACAAGAAAAGGTTGGTGTGTTTGTACGACGAGGTAAAGGTGGGCCTCTCTCTGT
rJMFF014E05+ ATACCCACAAGAAAAGGTTGGTGTGTTTGTACGACGAGGTAAAGGTGGGCCTCTCTCTGT
                      ____________________________________________________________
consensus ATACCCACAAGAAAAGGTTGGTGTGTTTGTACGACGAGGTAAAGGTGGGCCTCTCTCTGT
 
. : . : . : . : . : . :
JMFN025K04- GGTTGAATATAGTGAATTGGATCCTGAACTTTCAAGCG-CAATCAACCAAGTAAACTGGC
JMFN025K02- GGTTGAATATAGTGAATTGGATCCTGAACTTTCAAGCG-CAATCAACCAGG-AAACTGGC
rJMSF003E04+ GGTTGAATATAGTGAATTGGATCCTGAACTTTCAAGCG-CAATCAACCAGG-AAACTGGC
rJMFF014H02+ CAATCAACCAGG-AAACTGGC
rJMFF014E05+ GGTTGAATATAGTGAATTGGATCCTGAACTTTCAAGCGCCAATCAACCAGG-AAACTGGC
                      ____________________________________________________________
consensus GGTTGAATATAGTGAATTGGATCCTGAACTTTCAAGCG-CAATCAACCAGG-AAACTGGC
 
. : . : . : . : . : . :
JMFN025K04- CGACTTCGGTTTTGTTGGAGTAATGCTTGCTTGCATATGTTCACTCTGGAT
JMFN025K02- CGACTTCGTTTTTGTTGGAGTAATGTTTGCTTGCATATGTTTACTTTGGATTTCCTGAAT
rJMSF003E04+ CGACTTCGTTTTTGTTGGAGTAATGTTTGCTTGCATATGTTTACTTTGGATTTCCTGAAT
rJMFF014H02+ CGACTTCGTTTTTGTTGGAGTAATGTTTGCTTGCATATGTTTACTTTGGATTTCCTGAAT
rJMFF014E05+ CGACTTCGTTTTTGTTGGAGTAATGTTTGCTTGCATATGTTTACTTTGGATTTCCTGAAT
                      ____________________________________________________________
consensus CGACTTCGTTTTTGTTGGAGTAATGTTTGCTTGCATATGTTTACTTTGGATTTCCTGAAT
 
. : . : . : . : . : . :
JMFN025K02- CAAGTAGCAAATGGCCTTGAGAAAGACAGCATCTATCATCTTGCTGAGAAG-AAATTCCT
rJMSF003E04+ CAAGTAGCAAATGGCCTTGAGAAAGACAGCATCTATCATCTTGCTGAGAAGAAAATTCCT
rJMFF014H02+ CAAGTAGCAAATGGCCTTGAGAAAGACAGCATCTATCATCTTGCTGAGAAGAAAATTCCT
rJMFF014E05+ CAAGTAGCAAATGGCCTTGAGAAAGACAGCATCTATCATCTTGCTGAGAAGAAAATTCCT
                      ____________________________________________________________
consensus CAAGTAGCAAATGGCCTTGAGAAAGACAGCATCTATCATCTTGCTGAGAAGAAAATTCCT
 
. : . : . : . : . : . :
JMFN025K02- TCAGTCCATGGCTATA
rJMSF003E04+ TCAGTCCATGGCTATACAATGGGTTACAAACTAGAGCAGTTCATATTTGATGCATTTCCT
rJMFF014H02+ TCAGTCCATGGCTATACAATGGGTTACAAACTAGAGCAGTTCATATTTGATGCATTTCCT
rJMFF014E05+ TCAGTCCATGGCTATACAATGGGTTACAAACTAGAGCAGTTCATATTTGATGCATTTCCT
                      ____________________________________________________________
consensus TCAGTCCATGGCTATACAATGGGTTACAAACTAGAGCAGTTCATATTTGATGCATTTCCT
 
. : . : . : . : . : . :
rJMSF003E04+ TACAGCCCTTCAACAGCACTTTTTGAGGTACTGCGGGAAGAAGAATTTGCTCCAGTTAAA
rJMFF014H02+ TACAGCCCTTCAACAGCACTTTTTGAGGTACTGCGGGAAGAAGAATTTGCTCCAGTTAAA
rJMFF014E05+ TACAGCCCTTCAACAGCACTTTTTGAGGTACTGCGGGAAGAAGAATTTGCTCCAGTTAAA
                      ____________________________________________________________
consensus TACAGCCCTTCAACAGCACTTTTTGAGGTACTGCGGGAAGAAGAATTTGCTCCAGTTAAA
 
. : . : . : . : . : . :
rJMSF003E04+ AATGCAAATGGGGCAAACTTTGACACTCCAGACAGTGCCAGGCTGCTAGTTCTTCGCCTC
rJMFF014H02+ AATGCAAATGGGGCAAACTTTGACACTCCAGACAGTGCCAGGCTGCTAGTTCTTCGCCTC
rJMFF014E05+ AATGCAAATGGGGCAAACTTTGACACTCCAGACAGTGCCAGGCTGCTAGTTCTTCGCCTC
                      ____________________________________________________________
consensus AATGCAAATGGGGCAAACTTTGACACTCCAGACAGTGCCAGGCTGCTAGTTCTTCGCCTC
 
. : . : . : . : . : . :
rJMSF003E04+ CACACCCGTTGGGTGGTAGCTGCTGGAGGCTTCTTAACACATTCGGTGCCTTTGTATGCA
rJMFF014H02+ CACACCCGTTGGGTGGTAGCTGCTGGAGGCTTCTTAACACATTCGGTGCCTTTGTATGCA
rJMFF014E05+ CACACCCGTTGGGTGGTAGCTGCTGGAGGCTTCTTAACACATTCGGTGCCTTTGTATGCA
                      ____________________________________________________________
consensus CACACCCGTTGGGTGGTAGCTGCTGGAGGCTTCTTAACACATTCGGTGCCTTTGTATGCA
 
. : . : . : . : . : . :
rJMSF003E04+ ACAGGTGTCGAAGTTTCACCACTATGCTCATATGCTGGAGAAAATTTGGAAGCTATATGT
rJMFF014H02+ ACAGGTGTCGAAGTTTCACCACTATGCTCATATGCTGGAGAAAATTTGGAAGCTATATGT
rJMFF014E05+ ACAGGTGTCGAAGTTTCACCACTATGCTCATATGCTGGAGAAAATTTGGAAGCTATATGT
                      ____________________________________________________________
consensus ACAGGTGTCGAAGTTTCACCACTATGCTCATATGCTGGAGAAAATTTGGAAGCTATATGT
 
. : . : . : . : . : . :
rJMSF003E04+ CGTGGAAGAACATTCCATGCTCCTTGTGAAATCTCGTTTTAGTTTGGATTTTTAAAGGAC
rJMFF014H02+ CGTGGAAGAACATTCCATGCTCCTTGTGAAATCTCGTTTTAGTTTGGATTTTTAAAGGAC
rJMFF014E05+ CGTGGAAGAACATTCCATGCTCCTTGTGAAATCTCGTTTTAGTTTGGATTTTTAAAGGAC
                      ____________________________________________________________
consensus CGTGGAAGAACATTCCATGCTCCTTGTGAAATCTCGTTTTAGTTTGGATTTTTAAAGGAC
 
. : . : . : . : . : . :
rJMSF003E04+ AGCTTTTGAACTGAGCACAGATGTTTCTTGGATTGTATTTTTCTTTATTTTGTCTCCGAT
rJMFF014H02+ AGCTTTTGAACTGAGCACAGATGTTTCTTGGATTGTATTTTTCTTTATTTTGTCTCCGAT
rJMFF014E05+ AGCTTTTGAACTGAGCACAGATGTTTCTTGGATTGTATTTTTCTTTATTTTGTCTCCGAT
                      ____________________________________________________________
consensus AGCTTTTGAACTGAGCACAGATGTTTCTTGGATTGTATTTTTCTTTATTTTGTCTCCGAT
 
. : . : . : . : . : . :
rJMSF003E04+ CCGGTTGATATTTGTATGAGGGTTGTATTTGTGGTT
rJMFF014H02+ CCGGTTGATATTTGTATGAGGGTTGTATTTGTGGTTTTAACTTTTAATGGAGAGCTC
rJMFF014E05+ CCGGTTGATATTTGTATGAGGGTTGTATTTGTGGTTTTAACTTTTAATGGAGAGCTCTTA
                      ____________________________________________________________
consensus CCGGTTGATATTTGTATGAGGGTTGTATTTGTGGTTTTAACTTTTAATGGAGAGCTCTTA