Previous Contig 008860:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014D22Sequence538008860 (2)pir|D84448|D844482e-47probable ankyrin [imported] - Arabidopsis thaliana>gb:AC006284_1533998 Arabidops837008860 (2)gb:BT005259_16381992e-52Arabidopsis thaliana At2g03430 mRNA, complete cds.>gb:AK117252_1815296 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014D22- GGATTCGACACTCTACTTCCCCAGCA
                      ____________________________________________________________
consensus GGATTCGACACTCTACTTCCCCAGCA
 
. : . : . : . : . : . :
JMFF014D22- AAAACCCTGTAACAAAGCCCTCAGTACCCGGCATCCATGGCTATGGAAATAGATTCAACG
                      ____________________________________________________________
consensus AAAACCCTGTAACAAAGCCCTCAGTACCCGGCATCCATGGCTATGGAAATAGATTCAACG
 
. : . : . : . : . : . :
JMFF014D22- AAACCGACTCAAATAAAAGACAAAGACCTCTTCAAGGCCGCTGAATCGGGTAATTCTGAG
                      ____________________________________________________________
consensus AAACCGACTCAAATAAAAGACAAAGACCTCTTCAAGGCCGCTGAATCGGGTAATTCTGAG
 
. : . : . : . : . : . :
JMFF014D22- CTCTTCAAATCCCTCTCTGATGACCAGCTTCTCAAAGCCCTCGCTCTCCGCAACGAGGAT
                      ____________________________________________________________
consensus CTCTTCAAATCCCTCTCTGATGACCAGCTTCTCAAAGCCCTCGCTCTCCGCAACGAGGAT
 
. : . : . : . : . : . :
JMFF014D22- GCCCGCTCTCTTCTTCACGTCGCTGTCTCTTCTGCTCACACCGAGGTGGTAAAGATTGGC
                      ____________________________________________________________
consensus GCCCGCTCTCTTCTTCACGTCGCTGTCTCTTCTGCTCACACCGAGGTGGTAAAGATTGGC
 
. : . : . : . : . : . :
JMFF014D22- TGCTGCTGACTCTTCAATTAGCGGTATAAACAGTGGAGATGAAGAAGGTTGGGTGCCACT
                      ____________________________________________________________
consensus TGCTGCTGACTCTTCAATTAGCGGTATAAACAGTGGAGATGAAGAAGGTTGGGTGCCACT
 
. : . : . : . : . : . :
JMFF014D22- GCATTCTGCAGCAAGTAGTGGGAATATAGAAATTGTGG-AGATTTTGCTCAGCAGAGAAG
rJMFF014D22+ TGCAGCAAGTAGTGGGAATATAGAAATTGTGGNAGATTTTGCTCAGCAGAGAAG
                      ____________________________________________________________
consensus GCATTCTGCAGCAAGTAGTGGGAATATAGAAATTGTGGNAGATTTTGCTCAGCAGAGAAG
 
. : . : . : . : . : . :
JMFF014D22- CTAATGTTAATGCTAAAAATGATGGCGGTCGAACTGCTCTGCACTATGCTGCAAGCAAAG
rJMFF014D22+ CTAATGTTAATGCTAAAAATGATGGCGGTCGAACTGCTCTGCACTATGCTGCAAGCAAAG
                      ____________________________________________________________
consensus CTAATGTTAATGCTAAAAATGATGGCGGTCGAACTGCTCTGCACTATGCTGCAAGCAAAG
 
. : . : . : . : . : . :
JMFF014D22- GTCACTTCAGAGTAGCTGAAATTCTGATTTCACATGGTGCAAAGATCAATGCAAAAGACA
rJMFF014D22+ GTCACTTCAGAGTAGCTGAAATTTTGATTTCACATGGTGCAAAGATCAATGCAAAAGACA
                      ____________________________________________________________
consensus GTCACTTCAGAGTAGCTGAAATTTTGATTTCACATGGTGCAAAGATCAATGCAAAAGACA
 
. : . : . : . : . : . :
JMFF014D22- AGGTTGGATGCACCCCATTGCACCGGGCAGCTA
rJMFF014D22+ AGGTTGGATGCACCCCATTGCACCGGGCAGCTAGCACAGGGAAGTNTGATTTGTGCGAGC
                      ____________________________________________________________
consensus AGGTTGGATGCACCCCATTGCACCGGGCAGCTAGCACAGGGAAGTNTGATTTGTGCGAGC
 
. : . : . : . : . : . :
rJMFF014D22+ TNTTAATTGAGGAGGGTGCAGAAGTAGATGAATTGGATAGAGCAGGCGAGACTCCTCTCA
                      ____________________________________________________________
consensus TNTTAATTGAGGAGGGTGCAGAAGTAGATGAATTGGATAGAGCAGGCGAGACTCCTCTCA
 
. : . : . : . : . : . :
rJMFF014D22+ TGACTGCAGTCATATGCCACAATAGAGATGTGGCTCTGCTTCTCATAAGACATGGAGCAA
                      ____________________________________________________________
consensus TGACTGCAGTCATATGCCACAATAGAGATGTGGCTCTGCTTCTCATAAGACATGGAGCAA
 
. : . : . : . : . : . :
rJMFF014D22+ GTGTTGATGCCGAGGACAAGGAAGGCTACACTGTGCTTGGCCGAGCTTCAGATGATATTC
                      ____________________________________________________________
consensus GTGTTGATGCCGAGGACAAGGAAGGCTACACTGTGCTTGGCCGAGCTTCAGATGATATTC
 
. : . : . : . : . : . :
rJMFF014D22+ GGCCTGTATTAGTTGATGCTGCTAAAACCATGCTTGAAGGCTGAACTCCAAGAAGTACAC
                      ____________________________________________________________
consensus GGCCTGTATTAGTTGATGCTGCTAAAACCATGCTTGAAGGCTGAACTCCAAGAAGTACAC
 
. : . : . : . : . : . :
rJMFF014D22+ AAACTAATACACAGGGGCAAGTCATCTCTTATATGACGATAATCAGCACGCAGTCAAGTG
                      ____________________________________________________________
consensus AAACTAATACACAGGGGCAAGTCATCTCTTATATGACGATAATCAGCACGCAGTCAAGTG
 
. : . : . : . : . : . :
rJMFF014D22+ TAACTGTGTAAGAGCTTACTAAGACTCATAACCAGATTGTTGTCTTTAAGCTCAATTGAC
                      ____________________________________________________________
consensus TAACTGTGTAAGAGCTTACTAAGACTCATAACCAGATTGTTGTCTTTAAGCTCAATTGAC
 
. : . : . : . : . : . :
rJMFF014D22+ AACCATCATTTTGATGACCGGTGTTTGATATTGAAACTTGTTCTCACTATTACCATACTA
                      ____________________________________________________________
consensus AACCATCATTTTGATGACCGGTGTTTGATATTGAAACTTGTTCTCACTATTACCATACTA
 
. : . : . : . : . : . :
rJMFF014D22+ CTGTTTTTGCCTAAAATTGAGGGTTTTTTTTTGGCACTTCAAATATATTATACTCTGTAA
                      ____________________________________________________________
consensus CTGTTTTTGCCTAAAATTGAGGGTTTTTTTTTGGCACTTCAAATATATTATACTCTGTAA
 
. : . : . : . : . : . :
rJMFF014D22+ TAAGTACTGCTCAGATTTGCAATCCTTGCAATATAGAGGGGTGTGAAAATGATATGTAAT
                      ____________________________________________________________
consensus TAAGTACTGCTCAGATTTGCAATCCTTGCAATATAGAGGGGTGTGAAAATGATATGTAAT
 
. : . : . : . : . : . :
rJMFF014D22+ ACGTTAGCTTACAATTCACAGTCATTGCTAGTGTGCAGATAATCTAAACAATTATAAAAA
                      ____________________________________________________________
consensus ACGTTAGCTTACAATTCACAGTCATTGCTAGTGTGCAGATAATCTAAACAATTATAAAAA