Previous Contig 008858:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014D18Sequence568008858 (2)800008858 (2)pir|B84677|B846771e-40hypothetical protein At2g27800 [imported] - Arabidopsis thaliana>gb:AC005824_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014D18- GTATTATGTATTCTCCGATCTTCTACGCAGC
                      ____________________________________________________________
consensus GTATTATGTATTCTCCGATCTTCTACGCAGC
 
. : . : . : . : . : . :
JMFF014D18- TCTTCAGTATCCACGGCTTCAACCTTCTACCGCATAACCCACATTCAAATTTCAGCAACC
                      ____________________________________________________________
consensus TCTTCAGTATCCACGGCTTCAACCTTCTACCGCATAACCCACATTCAAATTTCAGCAACC
 
. : . : . : . : . : . :
JMFF014D18- ATTCAAGCAAACTTCAAGGAGAAAGCCGCCGGACCACTCCGTCTTCGCGGAATCCCAGCC
                      ____________________________________________________________
consensus ATTCAAGCAAACTTCAAGGAGAAAGCCGCCGGACCACTCCGTCTTCGCGGAATCCCAGCC
 
. : . : . : . : . : . :
JMFF014D18- ACACCGCCGCTGGATCGCGGCGGCCTTCGCCGTGTATTTGTCTCAGTCAGCAGCTCCCTC
rJMFF014D18+ TCAGTCAGCAGCTCCCTC
                      ____________________________________________________________
consensus ACACCGCCGCTGGATCGCGGCGGCCTTCGCCGTGTATTTGTCTCAGTCAGCAGCTCCCTC
 
. : . : . : . : . : . :
JMFF014D18- GACCGCTGTCCACTCCGACTAGTCGTAAATCCTACGACAGCAGCTTGCAGCTCCTCAGGC
rJMFF014D18+ GACCGCTGTCCACTCCGACTAGTCGTAAATCCTACGACAGCAGCTTGCAGCTCCTCAGGC
                      ____________________________________________________________
consensus GACCGCTGTCCACTCCGACTAGTCGTAAATCCTACGACAGCAGCTTGCAGCTCCTCAGGC
 
. : . : . : . : . : . :
JMFF014D18- ATTGCCTCCAGCTGTTATGCTCCAGTAAAGTAACCATGTATCGGGGTATGGTAATAGCAA
rJMFF014D18+ ATTGCCTCCAGCTGTTATGCTCCAGTAAAGTAACCATGTATCGGGGTATGGTAATAGCAA
                      ____________________________________________________________
consensus ATTGCCTCCAGCTGTTATGCTCCAGTAAAGTAACCATGTATCGGGGTATGGTAATAGCAA
 
. : . : . : . : . : . :
JMFF014D18- ATCATCCAAATGTATGTGTTTCCTTGATCTCCAAATGTGAGAAGTTATTTATAAATGCCC
rJMFF014D18+ ATCATCCAAATGTATGTGTTTCCTTGATCTCCAAATGTGAGAAGTTATTTATAAATGCCC
                      ____________________________________________________________
consensus ATCATCCAAATGTATGTGTTTCCTTGATCTCCAAATGTGAGAAGTTATTTATAAATGCCC
 
. : . : . : . : . : . :
JMFF014D18- ATTCCCATTACTCAAGTACATGCCATTTTCAGCGGCAATTACACAATTCGTCAAAATCTG
rJMFF014D18+ ATTCCCATTACTCAAGTACATGCCATTTTCAGCGGCAATTACACAATTCGTCAAAATCTG
                      ____________________________________________________________
consensus ATTCCCATTACTCAAGTACATGCCATTTTCAGCGGCAATTACACAATTCGTCAAAATCTG
 
. : . : . : . : . : . :
JMFF014D18- TAACGCTTTTGGCGAAAGAATGTTTTAATGCATCTATGATAAACTTTATTCCAGTTTCTT
rJMFF014D18+ TAACGCTTTTGGCGAAAGAATGTTTTAATGCATCTATGATAAACTTTATTCCAGTTTCTT
                      ____________________________________________________________
consensus TAACGCTTTTGGCGAAAGAATGTTTTAATGCATCTATGATAAACTTTATTCCAGTTTCTT
 
. : . : . : . : . : . :
JMFF014D18- TCTATTCTTCTGATGCAATCCGACGCCTGAGGGCCCCCCCAACAAGGTCTCTGAGAA
rJMFF014D18+ TCTATTCTTCTGATGCAATCCGACGCCTGAGGGCCCCCCCAACAAGGTCTCTGAGAAGGA
                      ____________________________________________________________
consensus TCTATTCTTCTGATGCAATCCGACGCCTGAGGGCCCCCCCAACAAGGTCTCTGAGAAGGA
 
. : . : . : . : . : . :
rJMFF014D18+ GGATGCGCAAAAGAGCTTTGGCTGCTGCCAAACCTGTTCTTGATGAATCCCGGGTTCAAA
                      ____________________________________________________________
consensus GGATGCGCAAAAGAGCTTTGGCTGCTGCCAAACCTGTTCTTGATGAATCCCGGGTTCAAA
 
. : . : . : . : . : . :
rJMFF014D18+ GGGCAATATCTCAACTTCCACCTAGATTTACCCCTGAGGAGCTGTTCAATGTCATGAATG
                      ____________________________________________________________
consensus GGGCAATATCTCAACTTCCACCTAGATTTACCCCTGAGGAGCTGTTCAATGTCATGAATG
 
. : . : . : . : . : . :
rJMFF014D18+ TAGAAGAAGATCCTTTGGTGTGTTTAGAATTGTTCAACTGGGCATCAACTCAACATAGGT
                      ____________________________________________________________
consensus TAGAAGAAGATCCTTTGGTGTGTTTAGAATTGTTCAACTGGGCATCAACTCAACATAGGT
 
. : . : . : . : . : . :
rJMFF014D18+ TCAGGCATGATGCCTCAACGTTCCACATAACCATACAGAGGCTTGGTGCAGTGAAAATGT
                      ____________________________________________________________
consensus TCAGGCATGATGCCTCAACGTTCCACATAACCATACAGAGGCTTGGTGCAGTGAAAATGT
 
. : . : . : . : . : . :
rJMFF014D18+ ATCAGGAGATGGATGTTGTTGTCAATCAAGTGCTTGCTGTTCCCTCTATTGGTTCTGAGG
                      ____________________________________________________________
consensus ATCAGGAGATGGATGTTGTTGTCAATCAAGTGCTTGCTGTTCCCTCTATTGGTTCTGAGG
 
. : . : . : . : . : . :
rJMFF014D18+ CACTTTACAATACTATGATATACTACTTCACAGAAGCTAGGAAGTTGACTAGAGCTGTAA
                      ____________________________________________________________
consensus CACTTTACAATACTATGATATACTACTTCACAGAAGCTAGGAAGTTGACTAGAGCTGTAA
 
. : . : . : . : . : . :
rJMFF014D18+ ATATATTTAAGCATATGCAGAACAGTAAGAAATTGGATTGCAGGCCGTCAATAAGAACTT
                      ____________________________________________________________
consensus ATATATTTAAGCATATGCAGAACAGTAAGAAATTGGATTGCAGGCCGTCAATAAGAACTT