Previous Contig 008848:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013E11Sequence560008848 (4)gb:AY075699_15678371e-87Arabidopsis thaliana AT4g18710/F28A21_120 mRNA, complete cds.
JMFF014A09Sequence729008848 (4)gb:AY075699_1567837e-124Arabidopsis thaliana AT4g18710/F28A21_120 mRNA, complete cds.
JMFF022F18Sequence272008039 (2)753008848 (4)gb:RC11591_1703302e-129R.communis mRNA for shaggy-like kinase, partial.
JMSF039K17Sequence460008848 (4)gb:AY075699_15678378e-14Arabidopsis thaliana AT4g18710/F28A21_120 mRNA, complete cds.122023864

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039K17- GATGGGCGATGTTTGGTTTCAT
                      ____________________________________________________________
consensus GATGGGCGATGTTTGGTTTCAT
 
. : . : . : . : . : . :
JMSF039K17- CTCATGGGTCCTCTCTCTCTCTTTCTCTTTCTCTTTCTCTTTCTCTCTCCTCTGAACCGA
                      ____________________________________________________________
consensus CTCATGGGTCCTCTCTCTCTCTTTCTCTTTCTCTTTCTCTTTCTCTCTCCTCTGAACCGA
 
. : . : . : . : . : . :
JMSF039K17- CAATTATGAGCTTTGAAGCATAAAGAACAGGAAAAAGAAAATACATTTCTCTTTCTCCCC
                      ____________________________________________________________
consensus CAATTATGAGCTTTGAAGCATAAAGAACAGGAAAAAGAAAATACATTTCTCTTTCTCCCC
 
. : . : . : . : . : . :
JMSF039K17- CTCCTTTTTCTTCCCCCTTGTTCTTTCTTTTCCTTCTTGATTTTTTTTTTTTAAAAATTT
                      ____________________________________________________________
consensus CTCCTTTTTCTTCCCCCTTGTTCTTTCTTTTCCTTCTTGATTTTTTTTTTTTAAAAATTT
 
. : . : . : . : . : . :
JMSF039K17- TCGTTTCATTTGTAGCTGCCNAGCTNAAAGTTANGGCCNAAAATCAGGAAATGTCNGCNC
JMFF013E11- GTTTCATTTGTAGCTGCCTAGCTGAGAGTTATGGCCGAAGATCAGGAGATGTCTGCTC
                      ____________________________________________________________
consensus TCGTTTCATTTGTAGCTGCCTAGCTGAGAGTTATGGCCGAAGATCAGGAGATGTCTGCTC
 
. : . : . : . : . : . :
JMSF039K17- CNGTTGGGGACGGGAAANATGCGGTTACGGGCCATATAANATCCACAACCATCGGGGGAA
JMFF013E11- CTGTTGTGGACGGGAAAGATGCGGTTACTGGCCATATAATATCCACAACCATCGGGGGAA
                      ____________________________________________________________
consensus CTGTTGTGGACGGGAAAGATGCGGTTACTGGCCATATAATATCCACAACCATCGGGGGAA
 
. : . : . : . : . : . :
JMSF039K17- ANAANGGANAGCCAAAGCAAACAGTTAGTTACANGGCAAAGCGNGTTGNCGGGACNGGGT
JMFF013E11- AGAATGGAGAGCCAAAGCAGACAGTTAGTTACATGGCAGAGCGTGTTGTCGGGACTGGGT
                      ____________________________________________________________
consensus AGAATGGAGAGCCAAAGCAGACAGTTAGTTACATGGCAGAGCGTGTTGTCGGGACTGGGT
 
. : . : . : . : . : . :
JMSF039K17- CATTCGGAGTTGTTTTTCAGGCAAAANGTCNCGAAACNGGGGAAACGGNGGCTATNAAAA
JMFF013E11- CATTCGGAGTTGTTTTTCAGGCAAAATGTCTCGAAACTGGGGAAACGGTGGCTATTAAGA
                      ____________________________________________________________
consensus CATTCGGAGTTGTTTTTCAGGCAAAATGTCTCGAAACTGGGGAAACGGTGGCTATTAAGA
 
. : . : . : . : . : . :
JMSF039K17- AGGNGTTGCAGGACAGGA
JMFF013E11- AGGTGTTGCAGGACAGGAGATACAAGAATCGTGAATTGCAGTTAATGCGCACAATGGATC
                      ____________________________________________________________
consensus AGGTGTTGCAGGACAGGAGATACAAGAATCGTGAATTGCAGTTAATGCGCACAATGGATC
 
. : . : . : . : . : . :
JMFF013E11- ACCCGAATGTTGTTTCTTTGAAGCACTGCTTCTATTCGACAACGACCACGGATGAGCTTT
                      ____________________________________________________________
consensus ACCCGAATGTTGTTTCTTTGAAGCACTGCTTCTATTCGACAACGACCACGGATGAGCTTT
 
. : . : . : . : . : . :
JMFF013E11- TTCTCAATTTAGTCATGGAATATGTCCCCGAGTCCATGTATCGGGTGCTCAAACATTATA
rJMFF022F18+ CCCCGAGTCCATGTATCGGGTGCTCAAACATTATA
rJMFF014A09+ AACATTATA
                      ____________________________________________________________
consensus TTCTCAATTTAGTCATGGAATATGTCCCCGAGTCCATGTATCGGGTGCTCAAACATTATA
 
. : . : . : . : . : . :
JMFF013E11- GCAATATGAACCAGCGGATGCCGCTCATTTATGTTAAACTCTACACGTATCAAGTATTTC
rJMFF022F18+ GCAATATGANCCAGCGGATGCCGCTCATTTATGTTAAACTCTACACGTATCAAGTATTTC
rJMFF014A09+ GCAATATGAACCAGCGGATGCCGCTCATTTATGTTAAACTCTACACGTATCAAGTATTTC
                      ____________________________________________________________
consensus GCAATATGAACCAGCGGATGCCGCTCATTTATGTTAAACTCTACACGTATCAAGTATTTC
 
. : . : . : . : . : . :
JMFF013E11- GAGGGCTGGCATACATGCACTCGGTTGCCGGAGTATGCCATAGAGACCTAAAACCGCAAA
rJMFF022F18+ GAGGGCTGGCATACATGCACTCGGTTGCCGGAGTATGCCATAGAGACCTAAAACCGCAAA
rJMFF014A09+ GAGGGCTGGCATACATGCACTCGGTTGCCGGAGTATGCCATAGAGACCTAAAACCGCAAA
                      ____________________________________________________________
consensus GAGGGCTGGCATACATGCACTCGGTTGCCGGAGTATGCCATAGAGACCTAAAACCGCAAA
 
. : . : . : . : . : . :
JMFF013E11- ATGTTCTGGTTGACCCTCTCAC
rJMFF022F18+ ATGTTCTGGTTGACCCTCTCACTCACCAGGTTAAGATTTGTGATTTCGGAAGTGCTAAAG
rJMFF014A09+ ATGTTCTGGTTGACCCTCTCACTCACCAGGTTAAGATTTGTGATTTCGGAAGTGCTAAAG
                      ____________________________________________________________
consensus ATGTTCTGGTTGACCCTCTCACTCACCAGGTTAAGATTTGTGATTTCGGAAGTGCTAAAG
 
. : . : . : . : . : . :
rJMFF022F18+ TCCTTGTTAAAGGTGAAGCAAACATATCATACATCTGCTCTCGGTTTTACCGGGCTCCCG
rJMFF014A09+ TCCTTGTTAAAGGTGAAGCAAACATATCATACATCTGCTCTCGGTTTTACCGGGCTCCCG
                      ____________________________________________________________
consensus TCCTTGTTAAAGGTGAAGCAAACATATCATACATCTGCTCTCGGTTTTACCGGGCTCCCG
 
. : . : . : . : . : . :
rJMFF022F18+ AACTCATATTTGGTGCAACAGAGTATACTACCTCAATTGATATATGGTCGGCTGGCTGTG
rJMFF014A09+ AACTCATATTTGGTGCAACAGAGTATACTACCTCAATTGATATATGGTCGGCTGGCTGTG
                      ____________________________________________________________
consensus AACTCATATTTGGTGCAACAGAGTATACTACCTCAATTGATATATGGTCGGCTGGCTGTG
 
. : . : . : . : . : . :
rJMFF022F18+ TCCTTGCAGAGCTTCTCCTTGGACAGCCGTTGTTTCCGGGAGAGAATGCCGTTGATCAAC
rJMFF014A09+ TCCTTGCAGAGCTTCTCCTTGGACAGCCGTTGTTTCCGGGAGAGAATGCCGTTGATCAAC
                      ____________________________________________________________
consensus TCCTTGCAGAGCTTCTCCTTGGACAGCCGTTGTTTCCGGGAGAGAATGCCGTTGATCAAC
 
. : . : . : . : . : . :
rJMFF022F18+ TTGTTGAGATAATCAAGGTTCTTGGAACACCAACCCGGGAGGAAATCCGCTGCATGAACC
rJMFF014A09+ TTGTTGAGATAATCAAGGTTCTTGGAACACCAACCCGGGAGGAAATCCGCTGCATGAACC
                      ____________________________________________________________
consensus TTGTTGAGATAATCAAGGTTCTTGGAACACCAACCCGGGAGGAAATCCGCTGCATGAACC
 
. : . : . : . : . : . :
rJMFF022F18+ CGAACTACACTGATTTTAGGTTTCCACAAATCAAGGCCCACCCTTGGCACAAGGTTTTCC
rJMFF014A09+ CGAACTACACTGATTTTAGGTTTCCACAAATCAAGGCCCACCCTTGGCACAAGGTTTTCC
                      ____________________________________________________________
consensus CGAACTACACTGATTTTAGGTTTCCACAAATCAAGGCCCACCCTTGGCACAAGGTTTTCC
 
. : . : . : . : . : . :
rJMFF022F18+ ACAAACGCATGCCTCCGGAAGCAATTGACCTTGCTTCTCGACTACTGCAGTACTCGCCAA
rJMFF014A09+ ACAAACGCATGCCTCCGGAAGCAATTGACCTTGCTTCTCGACTACTGCAGTACTCGCCAA
                      ____________________________________________________________
consensus ACAAACGCATGCCTCCGGAAGCAATTGACCTTGCTTCTCGACTACTGCAGTACTCGCCAA
 
. : . : . : . : . : . :
rJMFF022F18+ GTCTACGTTGCTCTGCTCTAGAAGCATGCGCACATCCTTTCTTCAATGAACACCGAGAGC
rJMFF014A09+ GTCTACGTTGCTCTGCTCTAGAAGCATGCGCACATCCTTTCTTCAATGAACACCGAGAGC
                      ____________________________________________________________
consensus GTCTACGTTGCTCTGCTCTAGAAGCATGCGCACATCCTTTCTTCAATGAACACCGAGAGC
 
. : . : . : . : . : . :
rJMFF022F18+ CTAATGCCCGCCTTCCAAACGGGCGTCCGTTGCCACCTCTTTTCAATTTTAAACAAGAGG
rJMFF014A09+ CTAATGCCCGCCTTCCAAACGGGCGTCCGTTGCCACCTCTTTTCAATTTTAAACAAGAGG
                      ____________________________________________________________
consensus CTAATGCCCGCCTTCCAAACGGGCGTCCGTTGCCACCTCTTTTCAATTTTAAACAAGAGG
 
. : . : . : . : . : . :
rJMFF022F18+ TACGCCTACGCCTATGTACTACAATTTTGTGATGTGAGGTTGGACCGTAAATGCTCTC
rJMFF014A09+ TACGCCTACGCCTATGTACTACAATTTTGTGATGTGAGGTTGGACCGTAAATGCTCTCCT
                      ____________________________________________________________
consensus TACGCCTACGCCTATGTACTACAATTTTGTGATGTGAGGTTGGACCGTAAATGCTCTCCT