Previous Contig 008845:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013P21Sequence574014331gb:NTA289862_16912968e-63Nicotiana tabacum mRNA for microtubule-associated protein MAP65-1a (map65-1a gen707008845 (4)gb:NTA289863_16912972e-58Nicotiana tabacum mRNA for microtubule-associated protein MAP65-1b (map65-1b gen
JMFN014K05Sequence521008845 (4)gb:NTA289864_16912985e-34Nicotiana tabacum mRNA for microtubule-associated protein MAP65-1c (map65-1c gen
JMFN031D10Sequence575008845 (4)gb:NTA289864_16912986e-31Nicotiana tabacum mRNA for microtubule-associated protein MAP65-1c (map65-1c gen
JMFN037H09Sequence478008845 (4)gb:NTA289864_16912984e-31Nicotiana tabacum mRNA for microtubule-associated protein MAP65-1c (map65-1c gen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031D10+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFN031D10+ TTAAAATCAGAATGGNAAACGTGTTAGCATAACGGGCTAATCTGTAAGTTCTCAGACCAC
rJMFF013P21- AACGTGTTAGCATAACGGGCTAATCTGTAAGTTCTCAGACCAC
                      ____________________________________________________________
consensus TTAAAATCAGAATGGNAAACGTGTTAGCATAACGGGCTAATCTGTAAGTTCTCAGACCAC
 
. : . : . : . : . : . :
JMFN031D10+ AAGATCTATGGGTAGTATGTAGTTTACCCCTCACTTATTTAAAGACTCCATAGCAATTAT
JMFN037H09+ ATTTAAAGACTCCATAGCAATTAT
JMFN014K05+ GGTAGTATGTAGTTTACCCCTCACTTATTTAAAGACTCCATAGCAATTAT
rJMFF013P21- AAGATCTATGGGTAGTATGTAGTTTACCCCTCACTTATTTAAAGACTCCATAGCAATTAT
                      ____________________________________________________________
consensus AAGATCTATGGGTAGTATGTAGTTTACCCCTCACTTATTTAAAGACTCCATAGCAATTAT
 
. : . : . : . : . : . :
JMFN031D10+ CATTACACCACAAACAGCTACACAAGTCTCTAATCTCAAATTACTGTCTACATACTTCCA
JMFN037H09+ CATTACACCACAAACAGCTACACAAGTCTCTAATCTCAAATTACTGTCTACATACTTCCA
JMFN014K05+ CATTACACCACAAACAGCTACACAAGTCTCTAATCTCAAATTACTGTCTACATACTTCCA
rJMFF013P21- CATTACACCACAAACAGCTACACAAGTCTCTAATCTCAAATTACTGTCTACATACTTCCA
                      ____________________________________________________________
consensus CATTACACCACAAACAGCTACACAAGTCTCTAATCTCAAATTACTGTCTACATACTTCCA
 
. : . : . : . : . : . :
JMFN031D10+ AGTCCCTTGTTCAAATACGTATTCTCTACTACAGTAACTAAGCTACTGATGATATTGCAA
JMFN037H09+ AGTCCCTTGTTCAAATACGTATTCTCTACTACAGTAACTAAGCTACTGATGATATTGCAA
JMFN014K05+ AGTCCCTTGTTCAAATACGTATTCTCTACTACAGTAACTAAGCTACTGATGATATTGCAA
rJMFF013P21- AGTCCCTTGTTCAAATACGTATTCTCTACTACAGTAACTAAGCTACTGATGATATTGCAA
                      ____________________________________________________________
consensus AGTCCCTTGTTCAAATACGTATTCTCTACTACAGTAACTAAGCTACTGATGATATTGCAA
 
. : . : . : . : . : . :
JMFN031D10+ AGGTATAAACATATGCAGATAGATCTCTCTTGCTCGTCGAAGACTATGGAGTAGTTGGAA
JMFN037H09+ AGGTATAAACATATGCAGATAGATCTCTCTTGCTCGTCGAAGACTATGGAGTAGTTGGAA
JMFN014K05+ AGGTATAAACATATGCAGATAGATCTCTCTTGCTCGTCGAAGACTATGGAGTAGTTGGAA
rJMFF013P21- AGGTATAAACATATGCAGATAGATCTCTCTTGCTCGTCGAAGACTATGGAGTAGTTGGAA
                      ____________________________________________________________
consensus AGGTATAAACATATGCAGATAGATCTCTCTTGCTCGTCGAAGACTATGGAGTAGTTGGAA
 
. : . : . : . : . : . :
JMFN031D10+ GAGGCTCGTTGCTGGAAATGTGGGAGGTTGAGTCCTCTTTTGATATGGCAACATAGTTCA
JMFN037H09+ GAGGCTCGTTGCTGGAAATGTGGGAGGTTGAGTCCTCTTTTGATATGGCAACATAGTTCA
JMFN014K05+ GAGGCTCGTTGCTGGAAATGTGGGAGGTTGAGTCCTCTTTTGATATGGCAACATAGTTCA
rJMFF013P21- GAGGCTCGTTGCTGGAAATGTGGGAGGTTGAGTCCTCTTTTGATATGGCAACATAGTTCA
                      ____________________________________________________________
consensus GAGGCTCGTTGCTGGAAATGTGGGAGGTTGAGTCCTCTTTTGATATGGCAACATAGTTCA
 
. : . : . : . : . : . :
JMFN031D10+ AAGGAACTGCGGCCCTTGCACTCTCTCTCCTCCCATCTTTAGATGTTGACCTGGAACCAT
JMFN037H09+ AAGGAACTGCGGCCCTTGCACTCTCTCTCCTCCCATCTTTAGATGTTGACCTGGAACCAT
JMFN014K05+ AAGGAACTGCGGCCCTTGCACTCTCTCTCCTCCCATCTTTAGATGTTGACCTGGAACCAT
rJMFF013P21- AAGGAACTGCGGCCCTTGCACTCTCTCTCCTCCCATCTTTAGATGTTGACCTGGAACCAT
                      ____________________________________________________________
consensus AAGGAACTGCGGCCCTTGCACTCTCTCTCCTCCCATCTTTAGATGTTGACCTGGAACCAT
 
. : . : . : . : . : . :
JMFN031D10+ TTTGATGGGAATTAAGAGACAACCTCCTGTTGGCGGTTCCATTGCCACTCCCGTTTGTTC
JMFN037H09+ TTTGATGGGAATTAAGAGACAACCTCCTGTTGGCGGTTCCATTGCCACTCCCGTTTGTTC
JMFN014K05+ TTTGATGGGAATTAAGAGACAACCTCCTGTTGGCGGTTCCATTGCCACTCCCGTTTGTTC
rJMFF013P21- TTTGATGGGAATTAAGAGACAACCTCCTGTTGGCGGTTCCATTGCCACTCCCGTTTGTTC
                      ____________________________________________________________
consensus TTTGATGGGAATTAAGAGACAACCTCCTGTTGGCGGTTCCATTGCCACTCCCGTTTGTTC
 
. : . : . : . : . : . :
JMFN031D10+ GGGGACCCACCACCTTTTTTGTGCCTAGTTGTCGAGCAGGGCTTGGTGTAGAACCAAACA
JMFN037H09+ GGGGACCCACCACCTTTTTTGTGCCTAGTTGTCGAGCAGGGCTTGGTGTAGAACCAAACA
JMFN014K05+ GGGGACCCACCACCTTTTTTGTGCCTAGTTGTCGAGCAGGGCTTGGTGTAGAACCAAACA
rJMFF013P21- GGGGACCCACCACCTTTTTTGTGCCTAGTTGTCGAGCAGGGCTTGGTGTAGAACCAAACA
                      ____________________________________________________________
consensus GGGGACCCACCACCTTTTTTGTGCCTAGTTGTCGAGCAGGGCTTGGTGTAGAACCAAACA
 
. : . : . : . : . : . :
JMFN031D10+ TTCCATCTTGCTCTTTGTTTATCTGTTCATGAAA
JMFN037H09+ TTCCATCTTGCTCTTTGTTTATCTGTTCATGAAA
JMFN014K05+ TTCCATCTTGCTCTTTGTTTATCTGTTCATGAAACTTCTTCTGGTCCCTCA
rJMFF013P21- TTCCATCTTGCTCTTTGTTTATCTGTTCATGAAACTTCTTCTGGTCCCTCAACCTTCTTT
                      ____________________________________________________________
consensus TTCCATCTTGCTCTTTGTTTATCTGTTCATGAAACTTCTTCTGGTCCCTCAACCTTCTTT
 
. : . : . : . : . : . :
rJMFF013P21- TCTCTTCTTCTCTGTCGTGCCTAAGCATCATGTACTCATCTAGCATAGCAAGCAGAGGAA
                      ____________________________________________________________
consensus TCTCTTCTTCTCTGTCGTGCCTAAGCATCATGTACTCATCTAGCATAGCAAGCAGAGGAA
 
. : . : . : . : . : . :
rJMFF013P21- CACCATCATAGGTGAACGTTGAGTCACGATCTTGTTCCCATGCCCGAGTTTTATTGATCA
                      ____________________________________________________________
consensus CACCATCATAGGTGAACGTTGAGTCACGATCTTGTTCCCATGCCCGAGTTTTATTGATCA