Previous Contig 008844:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013P17Sequence490008844 (5)pir|G86216|G862165e-21protein T23G18.14 [imported] - Arabidopsis thaliana>gb:AE005172_889835 Arabidops738008844 (5)pir|G86216|G862162e-56protein T23G18.14 [imported] - Arabidopsis thaliana>gb:AE005172_889835 Arabidops
JMFF022J17Sequence746008844 (5)pir|G86216|G862163e-65protein T23G18.14 [imported] - Arabidopsis thaliana>gb:AE005172_889835 Arabidops
JMSF035N07Sequence315007227 (2)654008844 (5)pir|G86216|G862165e-47protein T23G18.14 [imported] - Arabidopsis thaliana>gb:AE005172_889835 Arabidops
JMSF038J16Sequence242007227 (2)950008844 (5)pir|G86216|G862162e-88protein T23G18.14 [imported] - Arabidopsis thaliana>gb:AE005172_889835 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013P17- ATTCG
                      ____________________________________________________________
consensus ATTCG
 
. : . : . : . : . : . :
JMFF013P17- GCACAAAATGAAGCGGAAGGTGCGGCCACTCTTCAGCGTACTTCTGTTCATAGCTCTGGG
                      ____________________________________________________________
consensus GCACAAAATGAAGCGGAAGGTGCGGCCACTCTTCAGCGTACTTCTGTTCATAGCTCTGGG
 
. : . : . : . : . : . :
JMFF013P17- GGGGACGCTTTTCGTCCGGGTCGCTTTTCGGTATTGCTCTGTTCAGTCAAGAATCGGGAA
                      ____________________________________________________________
consensus GGGGACGCTTTTCGTCCGGGTCGCTTTTCGGTATTGCTCTGTTCAGTCAAGAATCGGGAA
 
. : . : . : . : . : . :
JMFF013P17- CCCATTTGCGAGAATGCCCCAAGCTGTAGTCTTTAACGACACCCTTCTCAAGTTTGCGAG
                      ____________________________________________________________
consensus CCCATTTGCGAGAATGCCCCAAGCTGTAGTCTTTAACGACACCCTTCTCAAGTTTGCGAG
 
. : . : . : . : . : . :
JMFF013P17- CCTGGATGTTGGGGAGCCTCAGTTGAGGAAGGAGGTAGATGAGCTTTTAGAAGGTAATTT
                      ____________________________________________________________
consensus CCTGGATGTTGGGGAGCCTCAGTTGAGGAAGGAGGTAGATGAGCTTTTAGAAGGTAATTT
 
. : . : . : . : . : . :
JMFF013P17- CAGAACCCATGGTCGCCATAGATCTTTCTTGTCTTCTGGTAGATATCATATTGACCTTAG
                      ____________________________________________________________
consensus CAGAACCCATGGTCGCCATAGATCTTTCTTGTCTTCTGGTAGATATCATATTGACCTTAG
 
. : . : . : . : . : . :
JMFF013P17- AATCAGGTCAGCTAAAGGGATGCCTTTGCAGCTCCGGTCCCCGGAGTTTAACCTGCTCTG
                      ____________________________________________________________
consensus AATCAGGTCAGCTAAAGGGATGCCTTTGCAGCTCCGGTCCCCGGAGTTTAACCTGCTCTG
 
. : . : . : . : . : . :
JMFF013P17- GCTGAGCTTCCGGAGGTATTTGCGTGATTGGTTTCGTAATAGGAAGCTTCAGACTGATTC
                      ____________________________________________________________
consensus GCTGAGCTTCCGGAGGTATTTGCGTGATTGGTTTCGTAATAGGAAGCTTCAGACTGATTC
 
. : . : . : . : . : . :
JMFF013P17- TATGATTGGTTTGTTAAATGGAGTAAAAGTTTTGATTGATAAGCACAATGGGAAATTTGG
rJMSF038J16+ ATTGGTTTGTTAAATGGAGTAAAAGTTTTGANTGATAAGCACAATGGGAAATTTGG
                      ____________________________________________________________
consensus TATGATTGGTTTGTTAAATGGAGTAAAAGTTTTGATTGATAAGCACAATGGGAAATTTGG
 
. : . : . : . : . : . :
JMFF013P17- AGTGG
rJMSF038J16+ AGTGGAGAAGGAGAGGTACAGTTCTGTGCAGTTGTGGGGAATAGTGGGATTTTATTGAAT
                      ____________________________________________________________
consensus AGTGGAGAAGGAGAGGTACAGTTCTGTGCAGTTGTGGGGAATAGTGGGATTTTATTGAAT
 
. : . : . : . : . : . :
rJMSF038J16+ AGTGAGTATGGGAAGGTGATTGATGGCCACGAGATTGTGATTCGATTGAACAATGCAAGA
                      ____________________________________________________________
consensus AGTGAGTATGGGAAGGTGATTGATGGCCACGAGATTGTGATTCGATTGAACAATGCAAGA
 
. : . : . : . : . : . :
rJMSF038J16+ ACTGGAGGGTTTGAGAGGAATGTAGGCTCAAAAACAACTATTTCCTTTGTGAATAGTAAC
rJMFF022J17+ GTGAATAGTAAC
                      ____________________________________________________________
consensus ACTGGAGGGTTTGAGAGGAATGTAGGCTCAAAAACAACTATTTCCTTTGTGAATAGTAAC
 
. : . : . : . : . : . :
rJMSF038J16+ ATATTGCATCTATGTGCCCGGAGGGAGGGGTGTTTCTGCCATCCTTACGGGCTAAACGTG
rJMFF022J17+ ATATTGCATCTATGTGCCCGGAGGGAGGGGTGTTTCTGCCATCNTTACGGGCTAAACGTG
rJMFF013P17+ TTACGGGCTAAACGTG
                      ____________________________________________________________
consensus ATATTGCATCTATGTGCCCGGAGGGAGGGGTGTTTCTGCCATCCTTACGGGCTAAACGTG
 
. : . : . : . : . : . :
rJMSF038J16+ GCGATGATTATGTATATTTGTCAACCGGTGCATTTCTTTGATTATCTGGCCTGCAATGCC
rJMFF022J17+ GCGATGATTATGTATATTTGTCAACCGGTGCATTTCTTTGATTATCTGGCCTGCGATGCC
rJMSF035N07+ ATGCC
rJMFF013P17+ GCGATGATTATGTATATTTGTCAACCGGTGCATTTCTTTGATTATCTGGCCTGCAATGCC
                      ____________________________________________________________
consensus GCGATGATTATGTATATTTGTCAACCGGTGCATTTCTTTGATTATCTGGCCTGCAATGCC
 
. : . : . : . : . : . :
rJMSF038J16+ TCCTTCAAGTCCCCATTGATTGTCACTGATCCTCGGTTCGATGTGATGTGTGCTAGGATT
rJMFF022J17+ TCCTTCAAGTCCCCATTGATTGTCACTGATCCTCGGTTCGATGTGATGTGTGCTAGGATT
rJMSF035N07+ TCCTTCAAGTCCCCATTGATTGTCACTGATCCTCGGTTCGATGTGATGTGTGCTAGGATT
rJMFF013P17+ TCCTTCAAGTCCCCATTGATTGTCACTGATCCTCGGTTCGATGTGATGTGTGCTAGGATT
                      ____________________________________________________________
consensus TCCTTCAAGTCCCCATTGATTGTCACTGATCCTCGGTTCGATGTGATGTGTGCTAGGATT
 
. : . : . : . : . : . :
rJMSF038J16+ GTGAAGTACTATTCATTGAAACGGTTTGTGGAGGCTTCAGGGAAGAACGTCGAGGAATGG
rJMFF022J17+ GTGAAGTACTATTCATTGAAACGGTTTGTGGAGGCTTCAGGGAAGAACGTCGAGGAATGG
rJMSF035N07+ GTGAAGTACTATTCATTGAAACGGTTTGTGGAGGCTTCAGGGAAGAACGTCGAGGAATGG
rJMFF013P17+ GTGAAGTACTATTCATTGAAACGGTTTGTGGAGGCTTCAGGGAAGAACGTCGAGGAATGG
                      ____________________________________________________________
consensus GTGAAGTACTATTCATTGAAACGGTTTGTGGAGGCTTCAGGGAAGAACGTCGAGGAATGG
 
. : . : . : . : . : . :
rJMSF038J16+ GGAGCCTCTCATGACGCGGTTAACTTTCATTACTCCTCGGGTATGCAGGCGGTGATGCTG
rJMFF022J17+ GGAGCCTCTCATGACGCGGTTAACTTTCATTACTCCTCGGGTATGCAGGCGGTGATGCTG
rJMSF035N07+ GGAGCCTCTCATGACGCGGTTAACTTTCATTACTCCTCGGGTATGCAGGCGGTGATGCTG
rJMFF013P17+ GGAGCCTCTCATGACGCGGTTAACTTTCATTACTCCTCGGGTATGCAGGCGGTGATGCTG
                      ____________________________________________________________
consensus GGAGCCTCTCATGACGCGGTTAACTTTCATTACTCCTCGGGTATGCAGGCGGTGATGCTG
 
. : . : . : . : . : . :
rJMSF038J16+ TCTTTAGGGTTGTGTGAGAAAGTTAGCGTTTTTGGATTTGGCAAATCCGCAGCAGCTAAA
rJMFF022J17+ TCTTTAGGGTTGTGTGAGAAAGTTAGCGTTTTTGGATTTGGCAAATCCGCAGCAGCTAAA
rJMSF035N07+ TCTTTAGGGTTGTGTGAGAAAGTTAGCGTTTTTGGATTTGGCAAATCCGCAGCAGCTAAA
rJMFF013P17+ TCTTTAGGGTTGTGTGAGAAAGTTAGCGTTTTTGGATTTGGCAAATCCGCAGCAGCTAAA
                      ____________________________________________________________
consensus TCTTTAGGGTTGTGTGAGAAAGTTAGCGTTTTTGGATTTGGCAAATCCGCAGCAGCTAAA
 
. : . : . : . : . : . :
rJMSF038J16+ CACCATTACCACACCAATCAGAAGGCCGAGCTCAAGTTGCATGACTATGAGGCAGAGTAT
rJMFF022J17+ CACCATTACCACACCAATCAGAAGGCCGAGCTCAAGTTGCATGACTATGAGGCAGAGTAT
rJMSF035N07+ CACCATTACCACACCAATCAGAAGGCCGAGCTCAAGTTGCATGACTATGAGGCAGAGTAT
rJMFF013P17+ CACCATTACCACACCAATCAGAAGGCCGAGCTCAAGTTGCATGACTATGAGGCAGAGTAT
                      ____________________________________________________________
consensus CACCATTACCACACCAATCAGAAGGCCGAGCTCAAGTTGCATGACTATGAGGCAGAGTAT
 
. : . : . : . : . : . :
rJMSF038J16+ GATTTCTACCGGGATTTGGTGGAGAGGCCTCAGGTAATACCATTCATCCCGGGTAATTTC
rJMFF022J17+ GATTTCTACCGGGATTTGGTGGAGAGGCCTCAGGTAATACCATTCATCCCGGGTAATTTC
rJMSF035N07+ GATTTCTACCGGGATTTGGTGGAGAGGCCTCAGGTAATACCATTCATCCCGGGTAATTTC
rJMFF013P17+ GATTTCTACCGGGATTTGGTGGAGAGGCCTCAGGTAATACCATTCATCCCGGGTAATTTC
                      ____________________________________________________________
consensus GATTTCTACCGGGATTTGGTGGAGAGGCCTCAGGTAATACCATTCATCCCGGGTAATTTC
 
. : . : . : . : . : . :
rJMSF038J16+ AAGGTTCCTCCCGTTGCTATATACCAATGATATTTTCCACGTTTACCACTTTGCCCTCAC
rJMFF022J17+ AAGGTTCCTCCCGTTGCTATATACCAATGATATTTTCCACGTTTACCACTTTGCCCTCAC
rJMSF035N07+ AAGGTTCCTCCCGTTGCTATATACCAATGATATTTTCCACGTTTACCACTTTGCCCTCAC
rJMFF013P17+ AAGGTTCCTCCCGTTGCTATATACCAATGATATTTTCCACGTTTACCACTTTGCCCTCAC
                      ____________________________________________________________
consensus AAGGTTCCTCCCGTTGCTATATACCAATGATATTTTCCACGTTTACCACTTTGCCCTCAC
 
. : . : . : . : . : . :
rJMSF038J16+ GTGCCATGCTTAGATTGTTTTGTCAAGTTCCATGCTTTCTTATGCTGTAATGGTAGTCTC
rJMFF022J17+ GTGCCATGCTTAGATTGTTTTGTCAAGTTCCATGCTTTCTTATGCTGTAATGGTAGTCTC
rJMSF035N07+ GTGCCATGCTTAGATTGTTTTGTCAAGTTCCATGCTTTCTTATGCTGTAATGGTAGTCTC
rJMFF013P17+ GTGCCATGCTTAGATTGTTTTGTCAAGTTCCATGCTTTCTTATGCTGTAATGGTAGTCTC
                      ____________________________________________________________
consensus GTGCCATGCTTAGATTGTTTTGTCAAGTTCCATGCTTTCTTATGCTGTAATGGTAGTCTC
 
. : . : . : . : . : . :
rJMSF038J16+ CCACTCTCCCACTCTCCCATGTGTAAGGTAACGGGAGGATATACTGTCTTAAAGACTTAA
rJMFF022J17+ CCACTCTCCCACTCTCCCATGTGTAAGGTAACGGGAGGATATACTGTCTTAAAGACTTAA
rJMSF035N07+ CCACTCTCCCACTCTCCCATGTGTAAGGTAACGGGAGGATATACTGTCTTAAAGACTTAA
rJMFF013P17+ CCACTCTCCCACTCTCCCATGTGTAAGGTAACGGGAGGATATACTGTCTTAAAGACTTAA
                      ____________________________________________________________
consensus CCACTCTCCCACTCTCCCATGTGTAAGGTAACGGGAGGATATACTGTCTTAAAGACTTAA
 
. : . : . : . : . : . :
rJMSF038J16+ ATATCAACGCCCCTGATTTGTGCAAGGTTCGGGGTGCAACTCAAGTGTAAAATG
rJMFF022J17+ ATATCAACGCCCCTGATTTGTGCAAGGTTCGGGGTGCAACTCAAGTGTAAAATGGAATAT
rJMSF035N07+ ATATCAACGCCCCTGATTTGTGCAAGGTTCGGGGTGCAACTCAAGTGTAAAATGGAATAT
rJMFF013P17+ ATATCAACGCCCCTGATTTGTGCAAGGTTCGGGGTGCAACTCAAGTGTAAAATGGAATAT
                      ____________________________________________________________
consensus ATATCAACGCCCCTGATTTGTGCAAGGTTCGGGGTGCAACTCAAGTGTAAAATGGAATAT
 
. : . : . : . : . : . :
rJMFF022J17+ GACAAGTGCTAAAT
rJMSF035N07+ GACAAGTGCTAAATTGTACGTTTTTTCAATCTTTGCAAGAGTGT
rJMFF013P17+ GACAAGTGCTAAATTGTACGTTTTTTCAATCTTTGCAAGAGTGTTCCAAGTCCTAATATA
                      ____________________________________________________________
consensus GACAAGTGCTAAATTGTACGTTTTTTCAATCTTTGCAAGAGTGTTCCAAGTCCTAATATA