Previous Contig 008835:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H14Sequence590007803 (14)gb:AY563043_16150059e-76Glycine max phosphoenolpyruvate carboxylase (PEPC17) mRNA, complete cds.683008835 (4)gb:AY563043_16150054e-87Glycine max phosphoenolpyruvate carboxylase (PEPC17) mRNA, complete cds.
JMFF013L07Sequence588007803 (14)gb:ATH532903_15528684e-76Arabidopsis thaliana mRNA for phosphoenolpyruvate carboxylase (ppc4 gene).714008835 (4)gb:AY563043_16150052e-86Glycine max phosphoenolpyruvate carboxylase (PEPC17) mRNA, complete cds.
JMFF037F02Sequence534007803 (14)gb:ATH532903_15528686e-67Arabidopsis thaliana mRNA for phosphoenolpyruvate carboxylase (ppc4 gene).723008835 (4)gb:AY563043_16150057e-90Glycine max phosphoenolpyruvate carboxylase (PEPC17) mRNA, complete cds.
JMSF047L19Sequence668007803 (14)gb:ATH532903_15528682e-71Arabidopsis thaliana mRNA for phosphoenolpyruvate carboxylase (ppc4 gene).731008835 (4)gb:AY563043_16150052e-93Glycine max phosphoenolpyruvate carboxylase (PEPC17) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047L19+ CACGAAGCCACGCCACAGGCCGAGCTTG
rJMFF037F02+ AGGCCGAGCTTG
                      ____________________________________________________________
consensus CACGAAGCCACGCCACAGGCCGAGCTTG
 
. : . : . : . : . : . :
rJMSF047L19+ GATTTCTCAACATAGGAAGCAGACCGACGAGGAGAAAGAGCTCGGTGGGAATAGGCCATC
rJMFF008H14+ TCAACATAGGAAGCAGACCGACGAGGAGAAAGAGCTCGGTGGGAATAGGCCATC
rJMFF037F02+ GATTTCTCAACATAGGAAGCAGACCGACGAGGAGAAAGAGCTCGGTGGGAATAGGCCATC
rJMFF013L07+ TCAACATAGGAAGCAGACCGACGAGGAGAAAGAGCTCGGTGGGAATAGGCCATC
                      ____________________________________________________________
consensus GATTTCTCAACATAGGAAGCAGACCGACGAGGAGAAAGAGCTCGGTGGGAATAGGCCATC
 
. : . : . : . : . : . :
rJMSF047L19+ TTCGAGCAATCCCATGGATATTCGCGTGGACACAGACCCGATTCGTGCTCCCTTCTTGGC
rJMFF008H14+ TTCGAGCAATCCCATGGATATTCGCGTGGACACAGACCCGATTCGTGCTCCCTTCTTGGC
rJMFF037F02+ TTCGAGCAATCCCATGGATATTCGCGTGGACACAGACCCGATTCGTGCTCCCTTCTTGGC
rJMFF013L07+ TTCGAGCAATCCCATGGATATTCGCGTGGACACAGACCCGATTCGTGCTCCCTTCTTGGC
                      ____________________________________________________________
consensus TTCGAGCAATCCCATGGATATTCGCGTGGACACAGACCCGATTCGTGCTCCCTTCTTGGC
 
. : . : . : . : . : . :
rJMSF047L19+ TCGGAGTTGGAGCCGGGATGAGAGGCGTCTGCGAGAAAGGCCACACCGAGGATCTTCGGG
rJMFF008H14+ TCGGAGTTGGAGCCGGGATGAGAGGCGTCTGCGAGAAAGGCCACACCGAGGATCTTCGGG
rJMFF037F02+ TCGGAGTTGGAGCCGGGATGAGAGGCGTCTGCGAGAAAGGCCACACCGAGGATCTTCGGG
rJMFF013L07+ TCGGAGTTGGAGCCGGGATGAGAGGCGTCTGCGAGAAAGGCCACACCGAGGATCTTCGGG
                      ____________________________________________________________
consensus TCGGAGTTGGAGCCGGGATGAGAGGCGTCTGCGAGAAAGGCCACACCGAGGATCTTCGGG
 
. : . : . : . : . : . :
rJMSF047L19+ CAATGTACAAAGACTGGCCTTTCTTTCAGTCCACTGTTGACCTCATAGAAATGGTTTTGG
rJMFF008H14+ CAATGTACAAAGACTGGCCTTTCTTTCAGTCCACTGTTGACCTCATAGAAATGGTTTTGG
rJMFF037F02+ CAATGTACAAAGACTGGCCTTTCTTTCAGTCCACTGTTGACCTCATAGAAATGGTTTTGG
rJMFF013L07+ CAATGTACAAAGACTGGCCTTTCTTTCAGTCCACTGTTGACCTCATAGAAATGGTTTTGG
                      ____________________________________________________________
consensus CAATGTACAAAGACTGGCCTTTCTTTCAGTCCACTGTTGACCTCATAGAAATGGTTTTGG
 
. : . : . : . : . : . :
rJMSF047L19+ GGAAAGCCGACAGCCCCATTGCGAAGTACTATGATGAAGTGTTGGTGTCCCCGAGCCGGC
rJMFF008H14+ GGAAAGCCGACAGCCCCATTGCGAAGTACTATGATGAAGTGTTGGTGTCCCCGAGCCGGC
rJMFF037F02+ GGAAAGCCGACAGCCCCATTGCGAAGTACTATGATGAAGTGTTGGTGTCCCCGAGCCGGC
rJMFF013L07+ GGAAAGCCGACAGCCCCATTGCGAAGTACTATGACGAAGTGTTGGTGTCCCCGAGCCGGC
                      ____________________________________________________________
consensus GGAAAGCCGACAGCCCCATTGCGAAGTACTATGATGAAGTGTTGGTGTCCCCGAGCCGGC
 
. : . : . : . : . : . :
rJMSF047L19+ AAGAACTCGGGGCCGAGCTAAGGAAAGAACTTCTGACGACAGAAAAGTATGTTCTGTTGG
rJMFF008H14+ AAGAACTCGGGGCCGAGCTAAGGAAAGAACTTCTGACGACAGAAAAGTATGTTCTGTTGG
rJMFF037F02+ AAGAACTCGGGGCCGAGCTAAGGAAAGAACTTCTGACGACAGAAAAGTATGTTCTGTTGG
rJMFF013L07+ AAGAACTCGGGGCCGAGCTAAGGAAAGAACTTCTGACGACAGAAAAGTATGTTCTGTTGG
                      ____________________________________________________________
consensus AAGAACTCGGGGCCGAGCTAAGGAAAGAACTTCTGACGACAGAAAAGTATGTTCTGTTGG
 
. : . : . : . : . : . :
rJMSF047L19+ TGACAGGACATGAGAAGCTGTCGGAGAACAACCGGAGTCTTAGGAGGTTGATTGAGAGCA
rJMFF008H14+ TGACAGGACATGAGAAGCTGTCGGAGAACAACCGGAGTCTTAGGAGGTTGATTGAGAGCA
rJMFF037F02+ TGACAGGACATGAGAAGCTGTCGGAGAACAACCGGAGTCTTAGGAGGTTGATTGAGAGCA
rJMFF013L07+ TGACAGGACATGAGAAGCTGTCGGAGAACAACCGGAGTCTTAGGAGGTTGGTTGAGAGCA
                      ____________________________________________________________
consensus TGACAGGACATGAGAAGCTGTCGGAGAACAACCGGAGTCTTAGGAGGTTGATTGAGAGCA
 
. : . : . : . : . : . :
rJMSF047L19+ GACTTCCTTACCTCAATCCCATGAACATTCTGCAGGTGGAGATACTGAAGAGGCTTCGTC
rJMFF008H14+ GACTTCCTTACCTCAATCCCATGAACATTCTGCAGGTGGAGATACTGAAGAGGNTTCGTC
rJMFF037F02+ GACTTCCTTACCTCAATCCCATGAACATTCTGCAGGTGGAGATACTGAAGAGGCTTCGTC
rJMFF013L07+ GACTTCCTTACCTCAATCCCATGAACATTCTGCAGGTGGAGATACTGAAGAGGCTTCGTC
                      ____________________________________________________________
consensus GACTTCCTTACCTCAATCCCATGAACATTCTGCAGGTGGAGATACTGAAGAGGCTTCGTC
 
. : . : . : . : . : . :
rJMSF047L19+ GCGACATCGATAACAACAAACTTCGAGACGCTTTGCTTATCACCATCAATGGGATTGCTG
rJMFF008H14+ GCGACATCGATAACAACAAACTTCGAGACGCTTTGCTTATCACCATCAATGGGATTGCTG
rJMFF037F02+ GCGACATCGATAACAACAAACTTCGAGACGCTTTGCTTATCACCATCAATGGGATTGCTG
rJMFF013L07+ GCGACATCGATAACAACAAACTTCGAGACGCTTTGCTTATCACCATCAATGGGATTGCTG
                      ____________________________________________________________
consensus GCGACATCGATAACAACAAACTTCGAGACGCTTTGCTTATCACCATCAATGGGATTGCTG
 
. : . : . : . : . : . :
rJMSF047L19+ CTGGGATGAGGAATACCGGTTAATTAACTGTCTAAGATCCTATGCCACTGTCTTTGAAAG
rJMFF008H14+ CTGGGATGAGGAATACCGGTTAATTAACTGTCTAAGATCCTATGCCACTGTCTTTGAAAG
rJMFF037F02+ CTGGGATGAGGAATACCGGTTAATTAACTGTCTAAGATCCTATGCCACTGTCTTTGAAAG
rJMFF013L07+ CTGGGATGAGGAATACCGGTTAATTAACTGTCTAAGATCCTATGCCACTGTCTTTGAAAG
                      ____________________________________________________________
consensus CTGGGATGAGGAATACCGGTTAATTAACTGTCTAAGATCCTATGCCACTGTCTTTGAAAG
 
. : . : . : . : . : . :
rJMSF047L19+ TGTAGTGAATTGTAAGGTATCCTTTTTGACTTACGTTAACTATTATCATGTTACTGGTTT
rJMFF008H14+ TGTAGTGAATTGTAAGGTATCCTTTTTGACTTACGTTAACTATTATCATGTTACTGGTTT
rJMFF037F02+ TGTAGTGAATTGTAAGGTATCCTTTTTGACTTACGTTAACTATTATCATGTTACTGGTTT
rJMFF013L07+ TGTAGTGAATTGTAAGGTATCCTTTTTGACTTACGTTAACTATTATCATGTTACTGGTTT
                      ____________________________________________________________
consensus TGTAGTGAATTGTAAGGTATCCTTTTTGACTTACGTTAACTATTATCATGTTACTGGTTT
 
. : . : . : . : . : . :
rJMSF047L19+ GTGACTGTCTTGGTATGTATATGTTTTTGATTGTGT
rJMFF008H14+ GTGACTGTCTTGGTATGTATATGT
rJMFF037F02+ GTGACTGTCTTGGTATGTATATGTTTTTGATTGTGTTGCTGGTTTCTTTCA
rJMFF013L07+ GTGACTGTCTTGGTATGTATATGTTTTTGATTGTGTTGCTGGTTTCTTTCAATAAATCAT
                      ____________________________________________________________
consensus GTGACTGTCTTGGTATGTATATGTTTTTGATTGTGTTGCTGGTTTCTTTCAATAAATCAT