Previous Contig 008831:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013K12Sequence520008831 (2)gb:ATAC016829_15436347e-70Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc750008831 (2)gb:ATAC016829_15436342e-76Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013K12- CCTTCATCAGTTCCGTGGTTCTTCAAAAACGGTG
                      ____________________________________________________________
consensus CCTTCATCAGTTCCGTGGTTCTTCAAAAACGGTG
 
. : . : . : . : . : . :
JMFF013K12- CTCTTTTATACAAATATGGAATGAATGGTGGCATAGCTGTCGACTCTCTAGGCTCAAATT
                      ____________________________________________________________
consensus CTCTTTTATACAAATATGGAATGAATGGTGGCATAGCTGTCGACTCTCTAGGCTCAAATT
 
. : . : . : . : . : . :
JMFF013K12- TGCCACCAGGGGGGGAAAACGATGGGGAATTTTGGCTTGATTTGCCAGATGATGACGATG
                      ____________________________________________________________
consensus TGCCACCAGGGGGGGAAAACGATGGGGAATTTTGGCTTGATTTGCCAGATGATGACGATG
 
. : . : . : . : . : . :
JMFF013K12- AAGCTAAGAATTATATCAAGTGTGGCAATATTGACAGTGCTGAACTGTATGTTCATGTAA
                      ____________________________________________________________
consensus AAGCTAAGAATTATATCAAGTGTGGCAATATTGACAGTGCTGAACTGTATGTTCATGTAA
 
. : . : . : . : . : . :
JMFF013K12- AGCCAGCTTTAGGGGGGACTTTCACCGATATTGCAATGTGGGTCTTTTGCCCCTTCAACG
rJMFF013K12+ TTGCAATGTGGNTCTTTTGCCCNTTCAACG
                      ____________________________________________________________
consensus AGCCAGCTTTAGGGGGGACTTTCACCGATATTGCAATGTGGGTCTTTTGCCCCTTCAACG
 
. : . : . : . : . : . :
JMFF013K12- GCCCAGCCACCTTAAAACTATGGTTGTGGGATTTCGAAATGAACAAAGTAGGCGAGCATG
rJMFF013K12+ GCCCAGCCACCTTAAAACTATGGTTGTGGGATTTCGAAATGAACAAAGTAGGCGAGCATG
                      ____________________________________________________________
consensus GCCCAGCCACCTTAAAACTATGGTTGTGGGATTTCGAAATGAACAAAGTAGGCGAGCATG
 
. : . : . : . : . : . :
JMFF013K12- TTGGTGATTGGGAGCATTACACTCTACGAATTAGCAACTTCACCGGAGAACTTTGGTCGG
rJMFF013K12+ TTGGTGATTGGGAGCATTACACTCTACGAATTAGCAACTTCACCGGAGAACTTTGGTCGG
                      ____________________________________________________________
consensus TTGGTGATTGGGAGCATTACACTCTACGAATTAGCAACTTCACCGGAGAACTTTGGTCGG
 
. : . : . : . : . : . :
JMFF013K12- TGTATTTCTCTGAGCACAGTGGCGGTGAATGGGTGGATGCCAGTGACCTGGAGTTTATCG
rJMFF013K12+ TGTATTTCTCTGAGCACAGTGGCGGTGAATGGGTGGATGCCAGTGACCTGGAGTTTATCG
                      ____________________________________________________________
consensus TGTATTTCTCTGAGCACAGTGGCGGTGAATGGGTGGATGCCAGTGACCTGGAGTTTATCG
 
. : . : . : . : . : . :
JMFF013K12- AGGGAAACAAGTGTATAGTATACTCATCAAGAAATGGCCACGCGAGCTTCCCTCATGCTG
rJMFF013K12+ AGGGAAACAAGTGTATAGTATACTCATCAAGAAATGGCCACGCGAGCTTCCCTCATGCTG
                      ____________________________________________________________
consensus AGGGAAACAAGTGTATAGTATACTCATCAAGAAATGGCCACGCGAGCTTCCCTCATGCTG
 
. : . : . : . : . : . :
JMFF013K12- GCTGTT
rJMFF013K12+ GCTGTTACCTTCAAGGCTCTTCGGTTCTTGGAATAGGAGTAAGGAATGATTGCGATACGA
                      ____________________________________________________________
consensus GCTGTTACCTTCAAGGCTCTTCGGTTCTTGGAATAGGAGTAAGGAATGATTGCGATACGA
 
. : . : . : . : . : . :
rJMFF013K12+ GCAAGTATTACCTGGACTCAAGCACCAAGTATCAAATCATTGCAGCTGAGCACCTCGGAG
                      ____________________________________________________________
consensus GCAAGTATTACCTGGACTCAAGCACCAAGTATCAAATCATTGCAGCTGAGCACCTCGGAG
 
. : . : . : . : . : . :
rJMFF013K12+ TGAGTCGTTGCAGAACCGCCTTGGTTACAGTACATGAGGGAGTGGGGCCCTACTATCGAA
                      ____________________________________________________________
consensus TGAGTCGTTGCAGAACCGCCTTGGTTACAGTACATGAGGGAGTGGGGCCCTACTATCGAA
 
. : . : . : . : . : . :
rJMFF013K12+ TACGATTCCACATCTGAGGTGGATAAGATAATCAACCACCTTCCCTTCTTCATTAGACTT
                      ____________________________________________________________
consensus TACGATTCCACATCTGAGGTGGATAAGATAATCAACCACCTTCCCTTCTTCATTAGACTT
 
. : . : . : . : . : . :
rJMFF013K12+ TCAGTGGAGACTCTCTTTGAACTGTTCCCAACTGAACTATATGGCGAGGCTGGGCCAACA
                      ____________________________________________________________
consensus TCAGTGGAGACTCTCTTTGAACTGTTCCCAACTGAACTATATGGCGAGGCTGGGCCAACA
 
. : . : . : . : . : . :
rJMFF013K12+ GGACCAAAAGAGAAGAACAATTGGTTTGGGGATGAAAGGTGAAGCAGATCGCATTTAAAA
                      ____________________________________________________________
consensus GGACCAAAAGAGAAGAACAATTGGTTTGGGGATGAAAGGTGAAGCAGATCGCATTTAAAA
 
. : . : . : . : . : . :
rJMFF013K12+ GCACCATGATTACCATGAAAGCTGCAGATTACCTATTGGTAATGTGAAATTGTAAAGAGA
                      ____________________________________________________________
consensus GCACCATGATTACCATGAAAGCTGCAGATTACCTATTGGTAATGTGAAATTGTAAAGAGA
 
. : . : . : . : . : . :
rJMFF013K12+ ACATTTTTTTGTCAGCTTTCTGTGCTAATTGTTGTCTGTATGTAATGCTTATAGAAGATT
                      ____________________________________________________________
consensus ACATTTTTTTGTCAGCTTTCTGTGCTAATTGTTGTCTGTATGTAATGCTTATAGAAGATT