Previous Contig 008829:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013K07Sequence583005547 (3)gb:ATU53501_15570790.021Arabidopsis thaliana chromosome I cosmid g8261 DNA (cytosine-5-) methyltransfera658008829 (2)gb:ATT30N20_15558201e-40Arabidopsis thaliana DNA chromosome 5, BAC clone T30N20 (ESSA project).
JMSF015G24Sequence262005547 (3)775008829 (2)gb:AC134344_17417478e-58Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015G24+ TTCTGGATTCCAACTTCAA
                      ____________________________________________________________
consensus TTCTGGATTCCAACTTCAA
 
. : . : . : . : . : . :
rJMSF015G24+ TGCCAAGCTTCAGATTTTGGCCTCGCTGTGCCAGATGGGGCCCAAAACAAGAACGACGCC
                      ____________________________________________________________
consensus TGCCAAGCTTCAGATTTTGGCCTCGCTGTGCCAGATGGGGCCCAAAACAAGAACGACGCC
 
. : . : . : . : . : . :
rJMSF015G24+ AAGCTCTCGGGAACCTTAGGATATGTAGCTCCAGAATACCTATTAGACGGAAAGTTAACT
                      ____________________________________________________________
consensus AAGCTCTCGGGAACCTTAGGATATGTAGCTCCAGAATACCTATTAGACGGAAAGTTAACT
 
. : . : . : . : . : . :
rJMSF015G24+ GATAAAAGCGATGTTTATGCATTTGGAGTTGTACTTTTGGAGCTTCTACTAGGAAGAAGG
rJMFF013K07+ TAAAAGCGATGTTTATGCATTTGGAGTTGTACTTTTGGAGCTTCTACTAGGAAGAAGG
                      ____________________________________________________________
consensus GATAAAAGCGATGTTTATGCATTTGGAGTTGTACTTTTGGAGCTTCTACTAGGAAGAAGG
 
. : . : . : . : . : . :
rJMSF015G24+ GCGATGGAGAAACTGGCACAAGGTCAGTGCCAATCCATTGTGTCATGGGCAATGCCGGAG
rJMFF013K07+ GCGATGGAGAAACTGGCACAAGGTCAGTGCCAATCCATTGTGTCATGGGCAATGCCGGAG
                      ____________________________________________________________
consensus GCGATGGAGAAACTGGCACAAGGTCAGTGCCAATCCATTGTGTCATGGGCAATGCCGGAG
 
. : . : . : . : . : . :
rJMSF015G24+ CTCACAGATAGATCAAAGCTCCCGAACATCGTGGATTCAGTGATCAGAAATACAATGGAT
rJMFF013K07+ CTCACAGATAGATCAAAGCTCCCGAACATCGTGGATTCAGTGATCAGAAATACAATGGAT
                      ____________________________________________________________
consensus CTCACAGATAGATCAAAGCTCCCGAACATCGTGGATTCAGTGATCAGAAATACAATGGAT
 
. : . : . : . : . : . :
rJMSF015G24+ TTAAAGCATTTATACCAGGTTGCAGCAGTAGCTGTGCTATGTGTCCAACCGGAGCCAAGT
rJMFF013K07+ TTAAAGCATTTATACCAGGTTGCAGCAGTAGCTGTGCTATGTGTCCAACCGGAGCCAAGT
                      ____________________________________________________________
consensus TTAAAGCATTTATACCAGGTTGCAGCAGTAGCTGTGCTATGTGTCCAACCGGAGCCAAGT
 
. : . : . : . : . : . :
rJMSF015G24+ TATCGTCCATTGATAACAGATGTGCTGCATTCTCTTATCCCCCTCGTTCCAATTGAGTTG
rJMFF013K07+ TATCGTCCATTGATAACAGATGTGCTGCATTCTCTCATCCCCCTCGTTCCAATTGAGTTG
                      ____________________________________________________________
consensus TATCGTCCATTGATAACAGATGTGCTGCATTCTCTTATCCCCCTCGTTCCAATTGAGTTG
 
. : . : . : . : . : . :
rJMSF015G24+ GGCGGGACGCTTAGAGCTTCTGCGACTGCACAAAACTCATGATTCTGGGAATGGAAGGAA
rJMFF013K07+ GGCGGGACGCTTAGAGCTTCTGCGACTGCACAAAACTCATGATTCTGGGAATGGAAGGAA
                      ____________________________________________________________
consensus GGCGGGACGCTTAGAGCTTCTGCGACTGCACAAAACTCATGATTCTGGGAATGGAAGGAA
 
. : . : . : . : . : . :
rJMSF015G24+ GTCTGCATCTTAGGACACTGCTCACTTCAATCTGTTTCTTGGCACAATATTTTGGTGATA
rJMFF013K07+ GTCTGCATCTTAGGACACTGCTCACTTCAATCTGTTTCTTGGCACAATATTTTGGTGATA
                      ____________________________________________________________
consensus GTCTGCATCTTAGGACACTGCTCACTTCAATCTGTTTCTTGGCACAATATTTTGGTGATA
 
. : . : . : . : . : . :
rJMSF015G24+ GTAAGCTGACAGAAGAAGAAGAATAAGAAGGTGAAGAAGGGACATTATTGGGCATTGCTA
rJMFF013K07+ GTAAGCTGACAGAAGAAGAAGAATAAGAAGGTGAAGAAGGGACATTATTGGGCATTGCTA
                      ____________________________________________________________
consensus GTAAGCTGACAGAAGAAGAAGAATAAGAAGGTGAAGAAGGGACATTATTGGGCATTGCTA
 
. : . : . : . : . : . :
rJMSF015G24+ ATTGGAATGGAATATATTTTATTTGTGAGTGAGAGTATTATTCATTACCTTGTATATTGA
rJMFF013K07+ ATTGGAATGGAATATATTTTATTTGTGAGTGAGAGTATTATTCATTACCTTGTATATTGA
                      ____________________________________________________________
consensus ATTGGAATGGAATATATTTTATTTGTGAGTGAGAGTATTATTCATTACCTTGTATATTGA
 
. : . : . : . : . : . :
rJMSF015G24+ TTGATTGAAGCCACACCCACCATGTGTAATTTAATTTGTTCTTTCTCACACTGGTGTACA
rJMFF013K07+ TTGATTGAAGCCACACCCACCATGTGTAATTTAATTTGTTCTTTCTCACACTGGTGTACA
                      ____________________________________________________________
consensus TTGATTGAAGCCACACCCACCATGTGTAATTTAATTTGTTCTTTCTCACACTGGTGTACA
 
. : . : . : . : . : . :
rJMSF015G24+ TATCAAGTGCCCTCCCAGAAACACACTG
rJMFF013K07+ TATCAAGTGCCCTCCCAGAAACACACTGTATTTGCAGATTTCCCATNAAAATCAAAAAAA
                      ____________________________________________________________
consensus TATCAAGTGCCCTCCCAGAAACACACTGTATTTGCAGATTTCCCATNAAAATCAAAAAAA