Previous Contig 008820:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013H15Sequence420014316gb:AF115543_17693212e-38Populus tremula x Populus tremuloides AUX1-like protein (LAX1) mRNA, complete cd692008820 (3)gb:AY864733_16310834e-68Populus tomentosa auxin influx protein (AUX1) mRNA, complete cds.
JMFF027O19Sequence318005375 (2)664008820 (3)gb:AY864733_16310831e-63Populus tomentosa auxin influx protein (AUX1) mRNA, complete cds.
JMSF013C03Sequence320005375 (2)790008820 (3)gb:AY864733_16310836e-86Populus tomentosa auxin influx protein (AUX1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013C03+ GTCTTCACATTAACGATC
                      ____________________________________________________________
consensus GTCTTCACATTAACGATC
 
. : . : . : . : . : . :
rJMSF013C03+ CCATCTGCTGCTGCCATGTATTGGGCCTACGGTGATCAGCTTCTCAGTAATGCCAATGCG
                      ____________________________________________________________
consensus CCATCTGCTGCTGCCATGTATTGGGCCTACGGTGATCAGCTTCTCAGTAATGCCAATGCG
 
. : . : . : . : . : . :
rJMSF013C03+ TTTGCACTCCTTCCCCAAAACGGTTTTCGCGATGCAGCTGTTGTTCTTATGCTAATCCAC
rJMFF027O19+ CCAC
rJMFF013H15+ GCGATGCAGCTGTTGTTCTTATGCTAATCCAC
                      ____________________________________________________________
consensus TTTGCACTCCTTCCCCAAAACGGTTTTCGCGATGCAGCTGTTGTTCTTATGCTAATCCAC
 
. : . : . : . : . : . :
rJMSF013C03+ CAGTTCATAACGTTCGGATTTGCTTGCACGCCACTGTACTTTGTTTGGGAGAAAGTGATA
rJMFF027O19+ CAGTTCATAACGTTCGGATTTGCTTGCACGCCACTGTACTTTGTTTGGGAGAAAGTGATA
rJMFF013H15+ CAGTTCATAACGTTCGGATTTGCTTGCACGCCACTGTACTTTGTTTGGGAGAAAGTGATA
                      ____________________________________________________________
consensus CAGTTCATAACGTTCGGATTTGCTTGCACGCCACTGTACTTTGTTTGGGAGAAAGTGATA
 
. : . : . : . : . : . :
rJMSF013C03+ GGGATGCACGACACGAAGAGCATATGTTTAAGGGCACTAGCGAGGTTACCGGTGGTGATA
rJMFF027O19+ GGGATGCACGACACGAAGAGCATATGTTTAAGAGCACTAGCGAGGTTACCGGTGGTGATA
rJMFF013H15+ GGGATGCACGACACGAAGAGCATATGTTTAAGGGCACTAGCGAGGTTACCGGTGGTGATA
                      ____________________________________________________________
consensus GGGATGCACGACACGAAGAGCATATGTTTAAGGGCACTAGCGAGGTTACCGGTGGTGATA
 
. : . : . : . : . : . :
rJMSF013C03+ CCGATATGGTTCTTGGCCATCATATTTCCCTTCTTCGGGCCTATCAACTCCGCTGTGGGA
rJMFF027O19+ CCGATATGGTTCTTGGCCATCATATTTCCCTTCTTCGGGCCTATCAACTCCGCTGTGGGA
rJMFF013H15+ CCGATATGGTTCTTGGCCATCATATTTCCCTTCTTCGGGCCTATCAACTCCGCTGTGGGA
                      ____________________________________________________________
consensus CCGATATGGTTCTTGGCCATCATATTTCCCTTCTTCGGGCCTATCAACTCCGCTGTGGGA
 
. : . : . : . : . : . :
rJMSF013C03+ GCACTTCTAGTTAGCTTCACCGTCTACATCATCCCCGCCCTCGCACACATGGTAACATAC
rJMFF027O19+ GCACTTCTAGTTAGCTTCACCGTCTACATCATCCCCGCCCTCGCACACATGGTAACATAC
rJMFF013H15+ GCACTTCTAGTTAGCTTCACCGTCTACATCATCCCCGCCCTCGCACACATGGTAACATAC
                      ____________________________________________________________
consensus GCACTTCTAGTTAGCTTCACCGTCTACATCATCCCCGCCCTCGCACACATGGTAACATAC
 
. : . : . : . : . : . :
rJMSF013C03+ AGAAAGGCGTCGGCCCGGCAGAATGCAGCAGAGAAACCCCCGTTCTTCCTACCGAGCTGG
rJMFF027O19+ AGAAAGGCGTCGGCCCGGCAGAATGCAGCAGAGAAACCCCCGTTCTTCCTACCGAGCTGG
rJMFF013H15+ AGAAAGGCGTCGGCCCGGCAGAATGCAGCAGAGAAACCCCCGTTCTTCCTACCGAGCTGG
                      ____________________________________________________________
consensus AGAAAGGCGTCGGCCCGGCAGAATGCAGCAGAGAAACCCCCGTTCTTCCTACCGAGCTGG
 
. : . : . : . : . : . :
rJMSF013C03+ ACCGCTGTGTATGTATTGAACGCATTCGTTGTGGTTTGGGTTTTAGTCGTCGGGTTTGGA
rJMFF027O19+ ACCGCTGTGTATGTATTGAACGCATTCGTTGTGGTTTGGGTTTTAGTCGTCGGGTTTGGA
rJMFF013H15+ ACCGCTGTGTATGTATTGAACGCATTCGTTGTGGTTTGGGTTTTAGTCGTCGGGTTTGGA
                      ____________________________________________________________
consensus ACCGCTGTGTATGTATTGAACGCATTCGTTGTGGTTTGGGTTTTAGTCGTCGGGTTTGGA
 
. : . : . : . : . : . :
rJMSF013C03+ TTCGGGGGGTGGGCAAGCATGAACAACTTCATCAAGCAAGTCGACACCTTCGGGCTATTC
rJMFF027O19+ TTCGGGGGGTGGGCAAGCATGAACAACTTCATCAAGCAAGTCGACACCTTCGGGCTATTC
rJMFF013H15+ TTCGGGGGGTGGGCAAGCATGAACAACTTCATCAAGCAAGTCGACACCTTCGGGCTATTC
                      ____________________________________________________________
consensus TTCGGGGGGTGGGCAAGCATGAACAACTTCATCAAGCAAGTCGACACCTTCGGGCTATTC
 
. : . : . : . : . : . :
rJMSF013C03+ GCGAAATGCTATCAGTGCAAGCACAAGTCTCCAGAAACCAATCACCATACATAGAAGGAA
rJMFF027O19+ GCGAAATGCTATCAGTGCAAGCACAAGTCTCCAGAAACCAATCACCATACATAGAAGGAA
rJMFF013H15+ GCGAAATGCTATCAGTGCAAGCACAAGTCTCCAGAAACCAATCACCATACATAGAAGGAA
                      ____________________________________________________________
consensus GCGAAATGCTATCAGTGCAAGCACAAGTCTCCAGAAACCAATCACCATACATAGAAGGAA
 
. : . : . : . : . : . :
rJMSF013C03+ GATCAGAAGATTTTCTTCATCACAGAAGATTTTAATGCTTTTTCTGACTTTCTGTTGGGG
rJMFF027O19+ GATCAGAAGATTTTCTTCATCACAGAAGATTTTAATGCTTTTTCTGACTTTCTGTTGGGG
rJMFF013H15+ GATCAGAAGATTTTCTTCATCACAGAAGATTTTAATGCTTTTTCTGACTTTCTGTTGGGG
                      ____________________________________________________________
consensus GATCAGAAGATTTTCTTCATCACAGAAGATTTTAATGCTTTTTCTGACTTTCTGTTGGGG
 
. : . : . : . : . : . :
rJMSF013C03+ GTTAATGTTGTAGTATCTTGTGTGTTTCTGTTTATGTTTTTGTGTTCAGAATATGTATAA
rJMFF027O19+ GTTAATGTTGTAGTATCTTGTGTGTTTCTGTTTATGTTTTTGTGTTCAGAATATGTATAA
rJMFF013H15+ GTTAATGTTGTAGTATCTTGTGTGTTTCTGTTTATGTTTTTGTGTTCAGAATATGTATAA
                      ____________________________________________________________
consensus GTTAATGTTGTAGTATCTTGTGTGTTTCTGTTTATGTTTTTGTGTTCAGAATATGTATAA
 
. : . : . : . : . : . :
rJMSF013C03+ AGATGTATAAGAAGATGAAATGGTGACAGTTTCTTAGTAGGCTCAGAAT
rJMFF027O19+ AGATGTATAAGAAGATGAAATGGTGACAGTTTCTTAGTAGGCTCAGAATTGTCTTTTTGC
rJMFF013H15+ AGATGTATAAGAAGATGAAATGGTGACAGTTTCTTAGTAGGCTCAGAATTGTCTTTTTGC
                      ____________________________________________________________
consensus AGATGTATAAGAAGATGAAATGGTGACAGTTTCTTAGTAGGCTCAGAATTGTCTTTTTGC