Previous Contig 008818:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013H04Sequence552008818 (2)gb:AY389714_11783271e-11Hyacinthus orientalis cell wall hydrolase mRNA, partial cds.694008818 (2)gb:AY389714_11783272e-11Hyacinthus orientalis cell wall hydrolase mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013H04- ATCAGTCATCACCGCCTAAAACCTCCCAAAAACC
rJMFF013H04+ ATCAGTCATCACCGCCTAAAACCTCCCAAAAACC
                      ____________________________________________________________
consensus ATCAGTCATCACCGCCTAAAACCTCCCAAAAACC
 
. : . : . : . : . : . :
JMFF013H04- GCTCATTTTCCGATCCAGAAACGCCAGCGGACCGTTGGATCGATGTGGAACAAGCGAGGA
rJMFF013H04+ GCTCATTTTCCGATCCAGAAACGCCAGCGGACCGTTGGATCGATGTGGAACAAGCGAGGA
                      ____________________________________________________________
consensus GCTCATTTTCCGATCCAGAAACGCCAGCGGACCGTTGGATCGATGTGGAACAAGCGAGGA
 
. : . : . : . : . : . :
JMFF013H04- CCAGCTGATGATTCCGCCGGCGACGGCGACGATAGGGAGAAAGCTATCGCTAAAACAGCT
rJMFF013H04+ CCAGCTGATGATTCCGCCGGCGACGGCGACGATAGGGAGAAAGCTATCGCTAAAACAGCT
                      ____________________________________________________________
consensus CCAGCTGATGATTCCGCCGGCGACGGCGACGATAGGGAGAAAGCTATCGCTAAAACAGCT
 
. : . : . : . : . : . :
JMFF013H04- GGATTCGTGGTCTTCTCAGGAATCGCGATGAGCATTATCAAAGCCCTCAACCCTTTCAAC
rJMFF013H04+ GGATTCGTGGTCTTCTCAGGAATCGCGATGAGCATTATCAAAGCCCTCAACCCTTTCAAC
                      ____________________________________________________________
consensus GGATTCGTGGTCTTCTCAGGAATCGCGATGAGCATTATCAAAGCCCTCAACCCTTTCAAC
 
. : . : . : . : . : . :
JMFF013H04- AATAATCCCAGCCTAAAAAAACGCCGACACTGAGTCGACTCAACCTCAAGTTCTTAAGCA
rJMFF013H04+ AATAATCCCAGCCTAAAAAAACGCCGACACTGAGTCGACTCAACCTCAAGTTCTTAAGCA
                      ____________________________________________________________
consensus AATAATCCCAGCCTAAAAAAACGCCGACACTGAGTCGACTCAACCTCAAGTTCTTAAGCA
 
. : . : . : . : . : . :
JMFF013H04- ATGGCAGCCTCAGGAGCTTCCGCCGCCTCCACCTCCACCTCAGCCTCCTTCTGAACCCAT
rJMFF013H04+ ATGGCAGCCTCAGGAGCTTCCGCCGCCTCCACCTCCACCTCAGCCTCCTTCTGAACCCAT
                      ____________________________________________________________
consensus ATGGCAGCCTCAGGAGCTTCCGCCGCCTCCACCTCCACCTCAGCCTCCTTCTGAACCCAT
 
. : . : . : . : . : . :
JMFF013H04- TGTAACGAAATCAACTTGTTGTTCGGAGCAAAACGCGGTGGAACCATCACCGAAGGTAAT
rJMFF013H04+ TGTAACGAAATCAACTTGTTGTTCGGAGCAAAACGCGGTGGAACCATCACCGAAGGTAAT
                      ____________________________________________________________
consensus TGTAACGAAATCAACTTGTTGTTCGGAGCAAAACGCGGTGGAACCATCACCGAAGGTAAT
 
. : . : . : . : . : . :
JMFF013H04- CGAGATTGTAAGAGGAGATACACTTTGGGGGCTGTCGAGAGAGTATGGGGTTTCAATTGA
rJMFF013H04+ CGAGATTGTAAGAGGAGATACACTTTGGGGGCTGTCGAGAGAGTATGGGGTTTCAATTGA
                      ____________________________________________________________
consensus CGAGATTGTAAGAGGAGATACACTTTGGGGGCTGTCGAGAGAGTATGGGGTTTCAATTGA
 
. : . : . : . : . : . :
JMFF013H04- GGCTATTAAGGAGGCTAATGATCTTAAAGGGGACACAATTTATGCAGGCAAGAAGCTTGT
rJMFF013H04+ GGCTATTAAGGAGGCTAATGATCTTAAAGGGGACACAATTTATGCAGGCAAGAAGCTTGT
                      ____________________________________________________________
consensus GGCTATTAAGGAGGCTAATGATCTTAAAGGGGACACAATTTATGCAGGCAAGAAGCTTGT
 
. : . : . : . : . : . :
JMFF013H04- AATACCATAAATCCATAATGTGGTTACCCTTTGTCTGT
rJMFF013H04+ AATACCATAAATCCATAATGTGGTTACCCTTTGTCTGTTGTTGTTAAGTTTTATCAGTTA
                      ____________________________________________________________
consensus AATACCATAAATCCATAATGTGGTTACCCTTTGTCTGTTGTTGTTAAGTTTTATCAGTTA
 
. : . : . : . : . : . :
rJMFF013H04+ GAGACTTAAAGGTTAGGGAATTCAGAAATTTGTTTGCTTGATGACATTGTAGAATTAAAC
                      ____________________________________________________________
consensus GAGACTTAAAGGTTAGGGAATTCAGAAATTTGTTTGCTTGATGACATTGTAGAATTAAAC
 
. : . : . : . : . : . :
rJMFF013H04+ AACTATGATGATTCTGGAAAATGGTGGTTGTTTATTTGGCAATGCTTGGTGTCCATACTA
                      ____________________________________________________________
consensus AACTATGATGATTCTGGAAAATGGTGGTTGTTTATTTGGCAATGCTTGGTGTCCATACTA