Previous Contig 008812:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013E10Sequence549008812 (5)gb:AP003905_18350174e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11183008812 (5)
JMSF013K23Sequence343011707 (5)gb:AF073830_17659381e-56Solanum tuberosum fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (F2K741008812 (5)gb:BT001917_16355207e-32Arabidopsis thaliana clone C105174 putative proline-rich protein (At4g00170) mRN
JMSF016O13Sequence459008812 (5)gb:AP003905_18350172e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11768008812 (5)gb:AP003905_18350174e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF016O13- TAGCTCTTCATTTTTTTTCTCAATTTCCATCC
JMFF013E10- GAGAGAAACCCTAGCTCTTCATTTTTTTTCTCAATTTCCATCC
                      ____________________________________________________________
consensus GAGAGAAACCCTAGCTCTTCATTTTTTTTCTCAATTTCCATCC
 
. : . : . : . : . : . :
JMSF016O13- AAATTTGCAATCCCGCACCTGTATACTCGTAAACCCAGTTATTCAAAGCTTTGGAGCTAA
JMFF013E10- AAATTTGCAATCCCGCACCTGTATACTCGTAAACCCAGTTATTCAAAGCTTTGGAGCTAA
                      ____________________________________________________________
consensus AAATTTGCAATCCCGCACCTGTATACTCGTAAACCCAGTTATTCAAAGCTTTGGAGCTAA
 
. : . : . : . : . : . :
JMSF016O13- TGGGCATGGGGGATTATCTGAATATTTATCCCGCAGAACTGAAATTCCAATTTGAGTTGA
JMFF013E10- TGGGCATGGGGGATTATCTGAATATTTATCCCGCAGAACTGAAATTCCAATTTGAGTTGA
                      ____________________________________________________________
consensus TGGGCATGGGGGATTATCTGAATATTTATCCCGCAGAACTGAAATTCCAATTTGAGTTGA
 
. : . : . : . : . : . :
JMSF016O13- GGAAGCAGAGTACATGCTCCTTGCAACTGACCAACAAGACTGATAGGTATATTGCCTTCA
JMFF013E10- GGAAGCAGAGTACATGCTCCTTGCAACTGACCAACAAGACTGATAGGTATATTGCCTTCA
rJMSF016O13+ CAAGACTGATAGGTATATTGCCTTCA
                      ____________________________________________________________
consensus GGAAGCAGAGTACATGCTCCTTGCAACTGACCAACAAGACTGATAGGTATATTGCCTTCA
 
. : . : . : . : . : . :
JMSF016O13- AGGTTAAAACGACTAACCCGAAGAAGTATTGTGTTCGCCCTAATGCTGGTGTTGTATTGC
JMFF013E10- AGGTTAAAACGACTAACCCGAAGAAGTATTGTGTTCGCCCTAATGCTGGTGTTGTATTGC
rJMSF016O13+ AGGTTAAAACGACTAACCCGAAGAAGTATTGTGTTCGCCCTAATGCTGGTGTTGTATTGC
rJMSF013K23+ GTGTTGTATTGC
                      ____________________________________________________________
consensus AGGTTAAAACGACTAACCCGAAGAAGTATTGTGTTCGCCCTAATGCTGGTGTTGTATTGC
 
. : . : . : . : . : . :
JMSF016O13- CCAACTCCACCTGCAATGTTATTGTTACAATGCAGGCACCGAGGGAGGCTCCTCCTGATA
JMFF013E10- CCAACTCCACCTGCAATGTTATTGTTACAATGCAGGCACCGAGGGAGGCTCCTCCTGATA
rJMSF016O13+ CCAACTCCACCTGCAATGTTATTGTTACAATGCAGGCACCGAGGGAGGCTCCTCCTGATA
rJMSF013K23+ CCAACTCCACCTGCAATGTTATTGTTACAATGCAGGCACCGAGGGAGGCTCCTCCTGATA
                      ____________________________________________________________
consensus CCAACTCCACCTGCAATGTTATTGTTACAATGCAGGCACCGAGGGAGGCTCCTCCTGATA
 
. : . : . : . : . : . :
JMSF016O13- TGCAACCCAAGGATAAGTTCCTAATTCAGAGCACTATTGCACCGGATGGTTCAACGTCTA
JMFF013E10- TGCAACCCAAGGATAAGTTCCTAATTCAGAGCACTATTGCACCGGATGGTTCAACGTCTA
rJMSF016O13+ TGCAACCCAAGGATAAGTTCCTAATTCAGAGCACTATTGCACCGGATGGTTCAACGTCTA
rJMSF013K23+ TGCAACCCAAGGATAAGTTCCTAATTCAGAGCACTATTGCACCGGATGGTTCAACGTCTA
                      ____________________________________________________________
consensus TGCAACCCAAGGATAAGTTCCTAATTCAGAGCACTATTGCACCGGATGGTTCAACGTCTA
 
. : . : . : . : . : . :
JMSF016O13- AGGACTTGTCACCGGAATTGTTTAATATGGAGGCTGGGAAAGTTATCAATGAACTTAAAT
JMFF013E10- AGGACTTGTCACCGGAATTGTTTAATATGGAGGCTGGGAAAGTTATCAATGAACTTAAAT
rJMSF016O13+ AGGACTTGTCACCGGAATTGTTTAATATGGAGGCTGGGAAAGTTATCAATGAACTTAAAT
rJMSF013K23+ AGGACTTGTCACCGGAATTGTTTAATATGGAGGCTGGGAAAGTTATCAATGAACTTAAAT
                      ____________________________________________________________
consensus AGGACTTGTCACCGGAATTGTTTAATATGGAGGCTGGGAAAGTTATCAATGAACTTAAAT
 
. : . : . : . : . : . :
JMSF016O13- TGAGG
JMFF013E10- TGAGGGTTGTTTATGTTCCCGCCAATCCTCCCTCACCAGTACCGGAAGAATCTGAAGAGG
rJMSF016O13+ TGAGGGTTGTTTATGTTCCCGCCAATCCTCCCTCACCAGTACCGGAAGAATCTGAAGAGG
rJMSF013K23+ TGAGGGTTGTTTATGTTCCCGCCAATCCTCCCTCACCAGTACCGGAAGAATCTGAAGAGG
                      ____________________________________________________________
consensus TGAGGGTTGTTTATGTTCCCGCCAATCCTCCCTCACCAGTACCGGAAGAATCTGAAGAGG
 
. : . : . : . : . : . :
JMFF013E10- GTTCTCCTCCAAGAGCTTTGAATGAG
rJMSF016O13+ GTTCTCCTCCAAGAGCTTTGAATGAGAATGAAACTAAAGTTTCTTCGTTGTCACAGGCTG
rJMSF013K23+ GTTCTCCTCCAAGAGCTTTGAATGAGAATGAAACTAAAGTTTCTTCGTTGTCACAGGCTG
                      ____________________________________________________________
consensus GTTCTCCTCCAAGAGCTTTGAATGAGAATGAAACTAAAGTTTCTTCGTTGTCACAGGCTG
 
. : . : . : . : . : . :
rJMSF016O13+ TATCAAGGTCTTTGGAGGAGCCCAAAGAAAAATTAGCATCTTCTGAGGCTTGGTCTTTGA
rJMSF013K23+ TATCAAGGTCTTTGGAGGAGCCCAAAGAAAAATTAGCATCTTCTGAGGCTTGGTCTTTGA
                      ____________________________________________________________
consensus TATCAAGGTCTTTGGAGGAGCCCAAAGAAAAATTAGCATCTTCTGAGGCTTGGTCTTTGA
 
. : . : . : . : . : . :
rJMSF016O13+ TTTCAAGGCTGACAGAGGAGAAAGGTTCTGCGGTTCAACAGAATCAGAAGCTACGTCAGG
rJMSF013K23+ TTTCAAGGCTGACAGAGGAGAAAGGTTCTGCGGTTCAACAGAATCAGAAGCTACGTCAGG
                      ____________________________________________________________
consensus TTTCAAGGCTGACAGAGGAGAAAGGTTCTGCGGTTCAACAGAATCAGAAGCTACGTCAGG
 
. : . : . : . : . : . :
rJMSF016O13+ AACTGGAGGCAGTAAGAAAAGAACTCAACAAAAGCAAAGCAGGCGGCTTCTCGGTGTTGT
rJMSF013K23+ AACTGGAGGCAGTAAGAAAAGAACTCAACAAAAGCAAAGCAGGCGGCTTCTCGGTGTTGT
                      ____________________________________________________________
consensus AACTGGAGGCAGTAAGAAAAGAACTCAACAAAAGCAAAGCAGGCGGCTTCTCGGTGTTGT
 
. : . : . : . : . : . :
rJMSF016O13+ TTGTGGTGCTCGTTGGGCTACTAGGTATTCTGCTCGGGTACTTCATCAGGAAGCGTTAGA
rJMSF013K23+ TTGTGGTGCTCGTTGGGCTACTAGGTATTCTGCTCGGGTACTTCATCAGGAAGCGTTAGA
                      ____________________________________________________________
consensus TTGTGGTGCTCGTTGGGCTACTAGGTATTCTGCTCGGGTACTTCATCAGGAAGCGTTAGA
 
. : . : . : . : . : . :
rJMSF016O13+ CGCTATTTGACAGGATTGTGGGGTGAGGCGATTTTCGACAGAATTGTGAATCAATCTCAA
rJMSF013K23+ CGCTATTTGACAGGATTGTGGGGTGAGGCGATTTTCGACAGAATTGTGAATCAATCTCAA
rJMFF013E10+ CAA
                      ____________________________________________________________
consensus CGCTATTTGACAGGATTGTGGGGTGAGGCGATTTTCGACAGAATTGTGAATCAATCTCAA
 
. : . : . : . : . : . :
rJMSF016O13+ GCCATTTGTTGTTTAGTATATTTTGTGTTGGTGTTAAAATGTTGGGTCTTTAGACATTAT
rJMSF013K23+ GCCATTTGTTGTTTAGTATATTTTGTGTTGGTGTTAAAATGTTGGGTCTTTAGACATTAT
rJMFF013E10+ GCCATTTGTTGNTTAGTATATTTNGTGTTGGTGNTAAAATGTTGGGTCTTTAGACATTAT
                      ____________________________________________________________
consensus GCCATTTGTTGTTTAGTATATTTTGTGTTGGTGTTAAAATGTTGGGTCTTTAGACATTAT
 
. : . : . : . : . : . :
rJMSF016O13+ GTATTTGTCTGACACAGAACAT
rJMSF013K23+ GTATTTGTCTGACACAGAACATTTTTCTTCTTTTACTAGGATAGACACATTCTTGGAAAC
rJMFF013E10+ GTATTTGTTTGACACAGAACATTTTTGTTCTTTTANTAGGATAGACACATTCTTGGAAAC
                      ____________________________________________________________
consensus GTATTTGTCTGACACAGAACATTTTTGTTCTTTTACTAGGATAGACACATTCTTGGAAAC
 
. : . : . : . : . : . :
rJMSF013K23+ TTATACATA
rJMFF013E10+ TTATACATATGATTTTGCCAAAGAGTCAAACACAGAATAAATTGTGTCNCCNATTTTTTT
                      ____________________________________________________________
consensus TTATACATATGATTTTGCCAAAGAGTCAAACACAGAATAAATTGTGTCNCCNATTTTTTT