Previous Contig 008811:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013D14Sequence516012510 (2)pir|G86453|G864532e-30YUP8H12R.39. homolog F9L11.9 [imported] - Arabidopsis thaliana>gb:AE005172_89212693008811 (2)pir|G86453|G864532e-57YUP8H12R.39. homolog F9L11.9 [imported] - Arabidopsis thaliana>gb:AE005172_89212
JMSF026P14Sequence667008811 (2)pir|G86453|G864535e-59YUP8H12R.39. homolog F9L11.9 [imported] - Arabidopsis thaliana>gb:AE005172_89212740012510 (2)pir|G86453|G864532e-25YUP8H12R.39. homolog F9L11.9 [imported] - Arabidopsis thaliana>gb:AE005172_89212

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026P14+ GACAACATGTACGTACCAATCTCATCACTCCAACCGGAGG
                      ____________________________________________________________
consensus GACAACATGTACGTACCAATCTCATCACTCCAACCGGAGG
 
. : . : . : . : . : . :
JMSF026P14+ CAGTGGAAGAACCCAAGATAAGCCGCATATACTGTGTCGCCGCAGAACAAATCAGGGAGC
                      ____________________________________________________________
consensus CAGTGGAAGAACCCAAGATAAGCCGCATATACTGTGTCGCCGCAGAACAAATCAGGGAGC
 
. : . : . : . : . : . :
JMSF026P14+ TCCAATCACAAGCCAACCATTACTCCGCGGACGAATTAAAACACCCAAGGAGGACGAAGC
                      ____________________________________________________________
consensus TCCAATCACAAGCCAACCATTACTCCGCGGACGAATTAAAACACCCAAGGAGGACGAAGC
 
. : . : . : . : . : . :
JMSF026P14+ TCGAAGCATTCTGTGCCTTCCTATGGAAAACAGTTGCCTCAGGGAAGAGTCGCCGGAATT
rJMFF013D14+ AAACAGTTGCNTCAGGGAAGAGTCGCCGGAATT
                      ____________________________________________________________
consensus TCGAAGCATTCTGTGCCTTCCTATGGAAAACAGTTGCCTCAGGGAAGAGTCGCCGGAATT
 
. : . : . : . : . : . :
JMSF026P14+ TCAAGAATTTCAAGTTGGGGATCGTGGTAGACGGGAGGACTAGACTAAGCATCGGCGACG
rJMFF013D14+ TCAAGAATTTCAAGTTGGGGATCGTGGTAGACGGGAGGACTAGACTAAGCATCGGCGACG
                      ____________________________________________________________
consensus TCAAGAATTTCAAGTTGGGGATCGTGGTAGACGGGAGGACTAGACTAAGCATCGGCGACG
 
. : . : . : . : . : . :
JMSF026P14+ AAAATAAGGCCAAATTTTTACAAGGGTACTTCGGAAACGTTCTTTCGTTTCCATTTGAAG
rJMFF013D14+ AAAATAAGGCCAAATTTTTACAAGGGTACTTCGGAAACGTTCTTTCGTTTCCATTTGAAG
                      ____________________________________________________________
consensus AAAATAAGGCCAAATTTTTACAAGGGTACTTCGGAAACGTTCTTTCGTTTCCATTTGAAG
 
. : . : . : . : . : . :
JMSF026P14+ AGAAAACGATTAAAGAACTGAGAGAAAAGCCGTTGAGTTGGGTGGCATCCGCCGTGCACG
rJMFF013D14+ AGAAAACGATTAAAGAACTGAGAGAAAAGCCGTTGAGTTGGGTGGCATCCGCCGTGCACG
                      ____________________________________________________________
consensus AGAAAACGATTAAAGAACTGAGAGAAAAGCCGTTGAGTTGGGTGGCATCCGCCGTGCACG
 
. : . : . : . : . : . :
JMSF026P14+ AGTTCTTAGAGGAAGCTCTGACGGGGGACCATTTCCTTGGGCTAATAGATTGGGTGGAGG
rJMFF013D14+ AGTTCTTAGAGGAAGCTCTGACGGGGGACCATTTCCTTGGGCTAATAGATTGGGTGGAGG
                      ____________________________________________________________
consensus AGTTCTTAGAGGAAGCTCTGACGGGGGACCATTTCCTTGGGCTAATAGATTGGGTGGAGG
 
. : . : . : . : . : . :
JMSF026P14+ CTCACCGCCCCGAGCCGGCCATACCGAAAGTACACGACTGCGTTGACGGAGCGGCGTTGG
rJMFF013D14+ CTCACCGCCCCGAGCCGGCCATACCGAAAGTACACGACTGCGTTGACGGAGCGGCGTTGG
                      ____________________________________________________________
consensus CTCACCGCCCCGAGCCGGCCATACCGAAAGTACACGACTGCGTTGACGGAGCGGCGTTGG
 
. : . : . : . : . : . :
JMSF026P14+ TGGTGTCGTCGGGGCAGCGGTTTCCGGTGAGAAAGATAGATTTTGGTTGGGGGAAGCCGG
rJMFF013D14+ TGGTGTCGTCGGGGCAGCGGTTTCCGGTGAGAAAGATAGATTTTGGTTGGGGGAAGCCGG
                      ____________________________________________________________
consensus TGGTGTCGTCGGGGCAGCGGTTTCCGGTGAGAAAGATAGATTTTGGTTGGGGGAAGCCGG
 
. : . : . : . : . : . :
JMSF026P14+ CGTTTGGATCGTATCATTTTCCGTGGGGTGGGCAATCGGGATACGTAATGCCGATGCCAA
rJMFF013D14+ CGTTTGGATCGTATCATTTTCCGTGGGGTGGGCAATCGGGATACGTAATGCCGATGCCAA
                      ____________________________________________________________
consensus CGTTTGGATCGTATCATTTTCCGTGGGGTGGGCAATCGGGATACGTAATGCCGATGCCAA
 
. : . : . : . : . : . :
JMSF026P14+ GTCCGAAAGGGAACGGAGATTGGA
rJMFF013D14+ GTCCGAAAGGGAACGGAGATTGGATTGTTTACATGCATCTGCAGAAAGAGAAGGTGGAAT
                      ____________________________________________________________
consensus GTCCGAAAGGGAACGGAGATTGGATTGTTTACATGCATCTGCAGAAAGAGAAGGTGGAAT
 
. : . : . : . : . : . :
rJMFF013D14+ TGATAGAGACTTATGCCTCACACGTCTTCAAACCTTTTACTTCAGATCATCTCAACTTCA
                      ____________________________________________________________
consensus TGATAGAGACTTATGCCTCACACGTCTTCAAACCTTTTACTTCAGATCATCTCAACTTCA
 
. : . : . : . : . : . :
rJMFF013D14+ ATTGATCATCCACCACCGTCGATCTCCATCTCATCATTCATAATTCAGTCTCGTTATACA
                      ____________________________________________________________
consensus ATTGATCATCCACCACCGTCGATCTCCATCTCATCATTCATAATTCAGTCTCGTTATACA
 
. : . : . : . : . : . :
rJMFF013D14+ ACATAATATATACATTAAATAAGTGTAATGTAAAGACTTGTAATAATTTTTAAAAAAAAG
                      ____________________________________________________________
consensus ACATAATATATACATTAAATAAGTGTAATGTAAAGACTTGTAATAATTTTTAAAAAAAAG