Previous Contig 008806:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013D05Sequence609008806 (6)gb:AC135205_17420162e-31Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se748008806 (6)
JMFF027F22Sequence456008806 (6)gb:AC135205_17420162e-30Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete se737008806 (6)
JMSF001D01Sequence377008806 (6)gb:BT005797_16387193e-19Arabidopsis thaliana clone C105468 putative transformer-SR ribonucleoprotein (At717008806 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027F22- AGAGTCTTCATATCTCAGAGCCTCAGACG
JMSF001D01- AGAGTCTTCATATCTCAGAGCCTCAGACG
JMFF013D05- ATTCGAGAGTCTTCATATCTCAGAGCCTCAGACG
                      ____________________________________________________________
consensus ATTCGAGAGTCTTCATATCTCAGAGCCTCAGACG
 
. : . : . : . : . : . :
JMFF027F22- TCCCCCCGGAAGAAGAGAACTGTGTCGTTCTACGAAAGCTAATTAACATGTCGTACTCCA
JMSF001D01- TCCCCCCGGAAGAAGAGAACTGTGTCGTTCTACGAAAGCTAATTAACATGTCGTACTCCA
JMFF013D05- TCCCCCCGGAAGAAGAGAACTGTGTCGTTCTACGAAAGCTAATTAACATGTCGTACTCCA
                      ____________________________________________________________
consensus TCCCCCCGGAAGAAGAGAACTGTGTCGTTCTACGAAAGCTAATTAACATGTCGTACTCCA
 
. : . : . : . : . : . :
JMFF027F22- AAAGATCAAGGTATTCACGCTCTCCTTCGTACAAGCATTACAGCAGATCTGTCTCAAGGT
JMSF001D01- AAAGATCAAGGTATTCACGCTCTCCTTCGTACAAGCATTACAGCAGATCTGTCTCAAGGT
JMFF013D05- AAAGATCAAGGTATTCACGCTCTCCTTCGTACAAGCATTACAGCAGATCTGTCTCAAGGT
                      ____________________________________________________________
consensus AAAGATCAAGGTATTCACGCTCTCCTTCGTACAAGCATTACAGCAGATCTGTCTCAAGGT
 
. : . : . : . : . : . :
JMFF027F22- CACTCTCTAAGTCCCCATCTGTATCAAGGAGCCCATCAAGGAGTCGGTACTCAAGTGATG
JMSF001D01- CACTCTCTAAGTCCCCATCTGTATCAAGGAGCCCATCAAGGAGTCGGTACTCAAGTGATG
JMFF013D05- CACTCTCTAAGTCCCCATCTGTATCAAGGAGCCCATCAAGGAGTCGGTACTCAAGTGATG
                      ____________________________________________________________
consensus CACTCTCTAAGTCCCCATCTGTATCAAGGAGCCCATCAAGGAGTCGGTACTCAAGTGATG
 
. : . : . : . : . : . :
JMFF027F22- CTGAAAATCCTGGGAATAATTTGTATGTAACTGGACTTTCAACCCGAGTGAGACAGAAGG
JMSF001D01- CTGAAAATCCTGGGAATAATTTGTATGTAACTGGACTTTCAACCCGAGTGAGACAGAAGG
JMFF013D05- CTGAAAATCCTGGGAATAATTTGTATGTAACTGGACTTTCAACCCGAGTGAGACAGAAGG
                      ____________________________________________________________
consensus CTGAAAATCCTGGGAATAATTTGTATGTAACTGGACTTTCAACCCGAGTGAGACAGAAGG
 
. : . : . : . : . : . :
JMFF027F22- ATCTTGAGAAGCATTTTTCTTCTGAGGGAAAGGTTGAAGATGTTCATCTTGTTATTGATC
JMSF001D01- ATCTTGAGAAGCATTTTTCTTCTGAGGGAAAGGTTGAAGATGTTCATCTTGTTATTGATC
JMFF013D05- ATCTTGAGAAGCATTTTTCTTCTGAGGGAAAGGTTGAAGATGTTCATCTTGTTATTGATC
                      ____________________________________________________________
consensus ATCTTGAGAAGCATTTTTCTTCTGAGGGAAAGGTTGAAGATGTTCATCTTGTTATTGATC
 
. : . : . : . : . : . :
JMFF027F22- CATGGACCAGAGAATCACGTGGATTTGCTTTTGTGACAATGTCCAAACTTGAAGATGCTG
JMSF001D01- CATGGACCAGAGAATCACGTGGATTTGCTTTTGTGACAATGTCCAA
JMFF013D05- CATGGACCAGAGAATCACGTGGATTTGCTTTTGTGACAATGTCCAAACTTGAAGATGCTG
                      ____________________________________________________________
consensus CATGGACCAGAGAATCACGTGGATTTGCTTTTGTGACAATGTCCAAACTTGAAGATGCTG
 
. : . : . : . : . : . :
JMFF027F22- ATAGGTGCATCAAGTATTTAAACCGGTCTGTGCTTGAAGGTCGTGTTATCACTGTTGAGA
JMFF013D05- ATAGGTGCATCAAGTATTTAAACCGGTCTGTGCTTGAAGGTCGTGTTATCACTGTTGAGA
                      ____________________________________________________________
consensus ATAGGTGCATCAAGTATTTAAACCGGTCTGTGCTTGAAGGTCGTGTTATCACTGTTGAGA
 
. : . : . : . : . : . :
JMFF027F22- AG
JMFF013D05- AGGCTAGGAGGAGAAGAGGCCGCACACCTACTCCCGGGAGGTATCTTGGATTGAGAATAG
rJMSF001D01+ GAATAG
rJMFF027F22+ GGGAGGTATCTTGGATTGAGAATAG
rJMFF013D05+ GGGAGGTATCTTGGATTGAGAATAG
                      ____________________________________________________________
consensus AGGCTAGGAGGAGAAGAGGCCGCACACCTACTCCCGGGAGGTATCTTGGATTGAGAATAG
 
. : . : . : . : . : . :
JMFF013D05- ATCGCGAGCGACGTTCACCAAGTTATTCCAGGAGTCGCTCTCCCCGATATTCTTCTGAGC
rJMSF001D01+ ATCGCGAGCGACGTTCACCAAGTTATTCCAGGAGTCGCTCTCCCCGATATTCTTCTGAGC
rJMFF027F22+ ATCGCGAGCGACGTTCACCAAGTTATTCCAGGAGTCGCTCTCCCCGATATTCTTCTGAGC
rJMFF013D05+ ATCGCGAGCGACGTTCACCAAGTTATTCCAGGAGTCGCTCTCCCCGATATTCTTNTGAGC
                      ____________________________________________________________
consensus ATCGCGAGCGACGTTCACCAAGTTATTCCAGGAGTCGCTCTCCCCGATATTCTTCTGAGC
 
. : . : . : . : . : . :
JMFF013D05- GAGACAGGAGCAGGAGCAGGAGCAGATCATACTCC
rJMSF001D01+ GAGACAGGAGCAGGAGCAGGAGCAGATCATACTCCCCGTATTATAGGCGCAGGCGCAGAT
rJMFF027F22+ GAGACAGGAGCAGGAGCAGGAGCAGATCATACTCCCCGTATTATAGGCGCAGGCGCAGAT
rJMFF013D05+ GAGACAGGAGCAGGAGCAGGAGCAGATCATACTCCCCGTATTATAGGCGCAGGCGCAGAT
                      ____________________________________________________________
consensus GAGACAGGAGCAGGAGCAGGAGCAGATCATACTCCCCGTATTATAGGCGCAGGCGCAGAT
 
. : . : . : . : . : . :
rJMSF001D01+ CATATTCACCACATTACAGTCGCCGGAGCCGCCACTCTTACTCTCCATATGGCCGTGGTA
rJMFF027F22+ CATATTCACCACATTACAGTCGCCGGAGCCGCCACTCTTACTCTCCATATGGCCGTGGTA
rJMFF013D05+ CATATTCACCACATTACAGTCGCCGGAGCCGCCACTCTTACTCTCCATATGGCCGTGGTA
                      ____________________________________________________________
consensus CATATTCACCACATTACAGTCGCCGGAGCCGCCACTCTTACTCTCCATATGGCCGTGGTA
 
. : . : . : . : . : . :
rJMSF001D01+ GATCCTACTCGAGATCTGTGTCCCGCTCCCCATCCAACTCTCCTTACTACTCTAGGTACC
rJMFF027F22+ GATCCTACTCGAGATCTGTGTCCCGCTCCCCATCCAACTCTCCTTACTACTCTAGGTACC
rJMFF013D05+ GATCCTACTCGAGATCTGTGTCCCGCTCCCCATCCAACTCTCCTTACTACTCTAGGTACC
                      ____________________________________________________________
consensus GATCCTACTCGAGATCTGTGTCCCGCTCCCCATCCAACTCTCCTTACTACTCTAGGTACC
 
. : . : . : . : . : . :
rJMSF001D01+ GTTCTCCTGATGATGGCTACTACTATAGGAGGAGCAGTTACCGCTCCCCTGATGATAGAG
rJMFF027F22+ GTTCTCCTGATGATGGCTACTACTATAGGAGGAGCAGTTACCGCTCCCCTGATGATAGAG
rJMFF013D05+ GTTCTCCTGATGATGGCTACTACTATAGGAGGAGCAGTTACCGCTCCCCTGATGATAGAG
                      ____________________________________________________________
consensus GTTCTCCTGATGATGGCTACTACTATAGGAGGAGCAGTTACCGCTCCCCTGATGATAGAG
 
. : . : . : . : . : . :
rJMSF001D01+ ATTATTATTACCGAAGAAGCCAACGGTATCGCTCAATCTCCCGGAGTATCTCACCACCCA
rJMFF027F22+ ATTATTATTACCGAAGAAGCCAACGGTATCGCTCAATCTCCCGGAGTATCTCACCACCCA
rJMFF013D05+ ATTATTATTACCGAAGAAGCCAACGGTATCGCTCAATCTCCCGGAGTATCTCACCACCCA
                      ____________________________________________________________
consensus ATTATTATTACCGAAGAAGCCAACGGTATCGCTCAATCTCCCGGAGTATCTCACCACCCA
 
. : . : . : . : . : . :
rJMSF001D01+ GGTATCGAAGGTACAGGAGAAGTTACTCACCCAGCGTATCTCCAAGGCGCCGCAGAAGAA
rJMFF027F22+ GGTATCGAAGGTACAGGAGAAGTTACTCACCCAGCGTATCTCCAAGGCGCCGCAGAAGAA
rJMFF013D05+ GGTATCGAAGGTACAGGAGAAGTTACTCACCCAGCGTATCTCCAAGGCGCCGCAGAAGAA
                      ____________________________________________________________
consensus GGTATCGAAGGTACAGGAGAAGTTACTCACCCAGCGTATCTCCAAGGCGCCGCAGAAGAA
 
. : . : . : . : . : . :
rJMSF001D01+ GCTACTCGAGAAGCGTCTCCCCGCCATCAAAGGACTTGAGAGGCTCCTATCGCAGCATTT
rJMFF027F22+ GCTACTCGAGAAGCGTCTCCCCGCCATCAAAGGACTTGAGAGGCTCCTATCGCAGCATTT
rJMFF013D05+ GCTACTCGAGAAGCGTCTCCCCGCCATCAAAGGACTTGAGAGGCTCCTATCGCAGCATTT
                      ____________________________________________________________
consensus GCTACTCGAGAAGCGTCTCCCCGCCATCAAAGGACTTGAGAGGCTCCTATCGCAGCATTT
 
. : . : . : . : . : . :
rJMSF001D01+ CTCCGAGTCCCAGGAAGAGTTCTAGGAGAAGTGGTTATGATAGTTGCTCTTCTAGAAGCC
rJMFF027F22+ CTCCGAGTCCCAGGAAGAGTTCTAGGAGAAGTGGTTATGATAGTTGCTCTTCTAGAAGCC
rJMFF013D05+ CTCCGAGTCCCAGGAAGAGTTCTAGGAGAAGTGGTTATGATAGTTGCTCTTCTAGAAGCC
                      ____________________________________________________________
consensus CTCCGAGTCCCAGGAAGAGTTCTAGGAGAAGTGGTTATGATAGTTGCTCTTCTAGAAGCC
 
. : . : . : . : . : . :
rJMSF001D01+ ATTCTAGGAGTGCAAGTCCATCTTCAAGATCTCATTCCAGATCTGTTATGTCCGATTCTG
rJMFF027F22+ ATTCTAGGAGTGCAAGTCCATCTTCAAGATCTCATTCCAGATCTGTTATGTCCGATTCTG
rJMFF013D05+ ATTCTAGGAGTGCAAGTCCATCTTCAAGATCTCATTCCAGATCTGTTATGTCCGATTCTG
                      ____________________________________________________________
consensus ATTCTAGGAGTGCAAGTCCATCTTCAAGATCTCATTCCAGATCTGTTATGTCCGATTCTG
 
. : . : . : . : . : . :
rJMSF001D01+ CCTCCCCTTCGCCATGAAAACCCCCCCACTTCATCTGTTGTAGGCATGTCTTTTTCTTAG
rJMFF027F22+ CCTCCCCTTCGCCATGAAAACCCCCCCACTTCATCTGTTGTAGGCATGTCTTTTTCTTAG
rJMFF013D05+ CCTCCCCTTCGCCATGAAAACCCCCCCACTTCATCTGTTGTAGGCATGTCTTTTTCTTAG
                      ____________________________________________________________
consensus CCTCCCCTTCGCCATGAAAACCCCCCCACTTCATCTGTTGTAGGCATGTCTTTTTCTTAG
 
. : . : . : . : . : . :
rJMSF001D01+ ATGGTTGTGGACTGAGACTAGTGTGTATTGAGACTTAAAGAGCT
rJMFF027F22+ ATGGTTGTGGACTGAGACTAGTGTGTATTGAGACTTAAAGAGCT
rJMFF013D05+ ATGGTTGTGGACTGAGACTAGTGTGTATTGAGACTTAAAGAGCTTAACCCCACTTTTATT
                      ____________________________________________________________
consensus ATGGTTGTGGACTGAGACTAGTGTGTATTGAGACTTAAAGAGCTTAACCCCACTTTTATT