Previous Contig 008797:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013A08Sequence690008797 (4)pir|F84668|F846686e-21hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153
JMFF039B05Sequence506003419 (3)pir|F84668|F846682e-25hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153692008797 (4)pir|F84668|F846681e-28hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153
JMSF018L06Sequence531003419 (3)pir|F84668|F846682e-26hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153710008797 (4)pir|F84668|F846681e-39hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153
JMSF027H13Sequence652006457 (2)pir|F84668|F846687e-35hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153818008797 (4)pir|F84668|F846683e-37hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018L06+ TTCAGCTCCATATCCTNTCAATAGCACATTCACCTGGAAACATGAAGCTCT
rJMSF027H13+ TTCACCTGGAANCATGNAGCTCT
                      ____________________________________________________________
consensus TTCAGCTCCATATCCTNTCAATAGCACATTCACCTGGAAACATGAAGCTCT
 
. : . : . : . : . : . :
rJMSF018L06+ CGATGAATAATTCAGAGTCTCGCCGCCAAATTACTATCCATCTTGAAAACGAGTTGCTAT
rJMSF027H13+ CGATGAATAATTCAGAGTCTCGCCGCCAAATTACTATCCATCTTGAAAACGAGTTGCTAT
                      ____________________________________________________________
consensus CGATGAATAATTCAGAGTCTCGCCGCCAAATTACTATCCATCTTGAAAACGAGTTGCTAT
 
. : . : . : . : . : . :
rJMSF018L06+ CCCTATCATCGAGCTTTACAAAGTGGATTGGTGCCCAGAAAACATACGTCGAA-GCTATA
rJMFF039B05+ GCCCAGAAAACATACGTNGAAGGCTATA
rJMSF027H13+ CCCTATCATCGAGCTTTACAAAGTGGATTGGTGCCCAGAAAACATACGTCGAA-GCTATA
                      ____________________________________________________________
consensus CCCTATCATCGAGCTTTACAAAGTGGATTGGTGCCCAGAAAACATACGTCGAA-GCTATA
 
. : . : . : . : . : . :
rJMSF018L06+ AACAAGTGGCTCTTAAAGTGCGTTTCCCTTAAAGAGCAATCGTCGAGGAGAAAAAGAAGG
rJMFF039B05+ AACAAGTGGCTCTTAAAGTGCGTTTCCCTTAAAGAGCAATCGTCGAGGAGAAAAAGAAGG
rJMSF027H13+ AACAAGTGGCTCTTAAAGTGCGTTTCCCTTAAAGAGCAATCGTCGAGGAGAAAAAGAAGG
                      ____________________________________________________________
consensus AACAAGTGGCTCTTAAAGTGCGTTTCCCTTAAAGAGCAATCGTCGAGGAGAAAAAGAAGG
 
. : . : . : . : . : . :
rJMSF018L06+ CCACCACAACAACCGCTGCTCAGATACTATGGCCCGCCCATATACATGATATGCGGTGTG
rJMFF039B05+ CCACCACAACAACCGCTGCTCAGATACTATGGCCCGCCCATATACATGATATGCGGTGTG
rJMSF027H13+ CCACCACAACAACCGCTGCTCAGATACTATGGCCCGCCCATATACATGATATGCGGTGTG
rJMFF013A08+ GGCCCGCCCATATNCATGATATGCGGTGTG
                      ____________________________________________________________
consensus CCACCACAACAACCGCTGCTCAGATACTATGGCCCGCCCATATACATGATATGCGGTGTG
 
. : . : . : . : . : . :
rJMSF018L06+ TGGTTAGACATGTTCACCGCTTTGCCTACTAAAGAAGTAACGGATGCTATGAAGGACTTA
rJMFF039B05+ TGGTTAGACATGTTCACCGCTTTGCCTACTAAAGAAGTAACGGATGCTATGAAGGACTTA
rJMSF027H13+ TGGTTAGACATGTTCACCGCTTTGCCTACTAAAGAAGTAACGGATGCTATGAAGGACTTA
rJMFF013A08+ TGGTTAGACATGTTCACCGCTTTGCCTNCTAAAGAAGTANCGGATGCTATGAAGGACTTA
                      ____________________________________________________________
consensus TGGTTAGACATGTTCACCGCTTTGCCTACTAAAGAAGTAACGGATGCTATGAAGGACTTA
 
. : . : . : . : . : . :
rJMSF018L06+ GCAGCAGAAATCACACATTTCTTACCACGTCAAGAGAAAACCAAAGGAAAGGGCATGAAC
rJMFF039B05+ GCAGCAGAAATCACACATTTCTTACCACGTCAAGAGAAAACCAAAGGAAAGGGCATGAAC
rJMSF027H13+ GCAGCAGAAATCACACATTTCTTACCACGTCAAGAGAAAACCAAAGGAAAGGGCATGAAC
rJMFF013A08+ GCAGCAGAAATCACACATTTCTTNCCACGTCAAGAGAAAACCAAAGGAAAGGGCATGAAC
                      ____________________________________________________________
consensus GCAGCAGAAATCACACATTTCTTACCACGTCAAGAGAAAACCAAAGGAAAGGGCATGAAC
 
. : . : . : . : . : . :
rJMSF018L06+ CATCGCCGTCCAAGGGACTGGCAAAGCGGTGCCAATAGCGATCTAGGCATCCCACCACCA
rJMFF039B05+ CATCGCCGTCCAAGGGACTGGCAAAGCGGTGCCAATAGCGATCTAGGCATCCCACCACCA
rJMSF027H13+ CATCGCCGTCCAAGGGACTGGCAAAGCGGTGCCAATAGCGATCTAGGCATCCCACCACCA
rJMFF013A08+ CATCGCCGTCCAAGGGACTGGCAAAGCGGTGCCAATAGCGATNTAGGCATCCCNCCACCA
                      ____________________________________________________________
consensus CATCGCCGTCCAAGGGACTGGCAAAGCGGTGCCAATAGCGATCTAGGCATCCCACCACCA
 
. : . : . : . : . : . :
rJMSF018L06+ CTTAGAGACGAGGCTTTGGAGGACTGGGTAATGGGGTATGATCACTTCCGTACGAGCATG
rJMFF039B05+ CTTAGAGACGAGGCTTTGGAGGACTGGGTAATGGGGTATGATCACTTCCGTACGAGCATG
rJMSF027H13+ CTTAGAGACGAGGCTTTGGAGGACTGGGTAATGGGGTATGATCACTTCCGTACGAGCATG
rJMFF013A08+ CTTAGAGACGAGGCTTTGGAGGACTGGGTAATGGGGTATGATCACTTCCGTNCGAGCATG
                      ____________________________________________________________
consensus CTTAGAGACGAGGCTTTGGAGGACTGGGTAATGGGGTATGATCACTTCCGTACGAGCATG
 
. : . : . : . : . : . :
rJMSF018L06+ GCCGTTTTCCTTGGTAAGTTAAACAACTTCGCCGAGTCTTCTGTGAAAAAGTTTGCCGAG
rJMFF039B05+ GCCGTTTTCCTTGGTAAGTTAAACAACTTCGCCGAGTCTTCTGTGAAAAAGTTTGCCGAG
rJMSF027H13+ GCCGTTTTCCTTGGTAAGTTAAACAACTTCGCCGAGTCTTCTGTGAAAAAGTTTGCCGAG
rJMFF013A08+ GCCGTTTTCCTTGGTAAGTTANACAACTTCGCCGAGTCTTCTGTGAAAAAGTTTGCCGAG
                      ____________________________________________________________
consensus GCCGTTTTCCTTGGTAAGTTAAACAACTTCGCCGAGTCTTCTGTGAAAAAGTTTGCCGAG
 
. : . : . : . : . : . :
rJMSF018L06+ CTCCAAAATTCTACTGAAAAAGCGAAAAAAAGCTATGCACAGGTGAGGTCAACAGAGCAA
rJMFF039B05+ CTCCAAAATTCTACTGAAAAAGCGAAAAAAAGCTATGCACAGGTGAGGTCAACAGAGCAA
rJMSF027H13+ CTCCAAAATTCTACTGAAAAAGCGAAAAAAAGCTATGCACAGGTGAGGTCAACAGAGCAA
rJMFF013A08+ CTCCAAAATTNTACTGAAAAAGCGAAAAAAAGCTATGCACAGGTGAGGTCAACAGAGCAA
                      ____________________________________________________________
consensus CTCCAAAATTCTACTGAAAAAGCGAAAAAAAGCTATGCACAGGTGAGGTCAACAGAGCAA
 
. : . : . : . : . : . :
rJMSF018L06+ TAACTAACATTGTTGTTTATTCATCTCAAAATCTGAAATGGCTTCATATTCTTGAAGAAC
rJMFF039B05+ TAACTAACATTGTTGTTTATTCATCTCAAAATCTGAAATGGCTTCATATTCTTGAAGAAC
rJMSF027H13+ TAACTAACATTGTTGTTTATTCATCTCAAAATCTGAAATGGCTTCATATTCTTGAAGAAC
rJMFF013A08+ TAACTAACATTGTTGTTTATTCATCTCAAAATCTGAAATGGCTTCATATTCTTGAAGAAC
                      ____________________________________________________________
consensus TAACTAACATTGTTGTTTATTCATCTCAAAATCTGAAATGGCTTCATATTCTTGAAGAAC
 
. : . : . : . : . : . :
rJMFF039B05+ ACAGTCATTATGTATATTATATTGAAGCAGTGACTACAAGAAAGAAAGAAAGAAAGGATG
rJMSF027H13+ ACAGTCATTATGTATATTATATTGAAGCAGTGACTACAAGAAAGAAAGAAAGAAAGGATG
rJMFF013A08+ ACAGTCATTATGTATATTATATTGAAGCAGTGNCTACAAGAAAGAAAGAAAGAAAGGATG
                      ____________________________________________________________
consensus ACAGTCATTATGTATATTATATTGAAGCAGTGACTACAAGAAAGAAAGAAAGAAAGGATG
 
. : . : . : . : . : . :
rJMFF039B05+ AGCTGTACAGAGGTGAAATGAATTGAAAGAAGTAAATTCATTAGAGGTTTTAGCTT
rJMSF027H13+ AGCTGTACAGAGGTGAAATGAATTGAAAGAAGTAAATTCATTAGAGGTTTTAGCTT
rJMFF013A08+ AGCTGTACAGAGGTGAAATGAATTGAAAGAAGTAAATTCATTAGAGGTTTTAGCTTTAGA
                      ____________________________________________________________
consensus AGCTGTACAGAGGTGAAATGAATTGAAAGAAGTAAATTCATTAGAGGTTTTAGCTTTAGA
 
. : . : . : . : . : . :
rJMFF013A08+ AAAGATTGGTNGAAATAAAATTANAGAGTTCAGTATAGTCATTTTATGNGTAGACAGCAT
                      ____________________________________________________________
consensus AAAGATTGGTNGAAATAAAATTANAGAGTTCAGTATAGTCATTTTATGNGTAGACAGCAT
 
. : . : . : . : . : . :
rJMFF013A08+ GATCAGTTTTGTAGGACAAATCAATATGCTACAGATAAAAGAGAATCATATATAGTACCA
                      ____________________________________________________________
consensus GATCAGTTTTGTAGGACAAATCAATATGCTACAGATAAAAGAGAATCATATATAGTACCA