Previous Contig 008786:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012L19Sequence510003230 (16)pir|T05768|T057684e-54subtilisin-like proteinase (EC 3.4.21.-) - Arabidopsis thaliana>gb:ATCHRIV82_154745008786 (3)pir|T05768|T057681e-31subtilisin-like proteinase (EC 3.4.21.-) - Arabidopsis thaliana>gb:ATCHRIV82_154
JMFF028I01Sequence540003230 (16)pir|T05768|T057689e-50subtilisin-like proteinase (EC 3.4.21.-) - Arabidopsis thaliana>gb:ATCHRIV82_154636008786 (3)pir|T05768|T057687e-21subtilisin-like proteinase (EC 3.4.21.-) - Arabidopsis thaliana>gb:ATCHRIV82_154
JMFS159C11Sequence424008786 (3)pir|T05768|T057681e-12subtilisin-like proteinase (EC 3.4.21.-) - Arabidopsis thaliana>gb:ATCHRIV82_154

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012L19+ TGCCCAATGAAGAAGCCAGTGCCAG
                      ____________________________________________________________
consensus TGCCCAATGAAGAAGCCAGTGCCAG
 
. : . : . : . : . : . :
rJMFF012L19+ AGAATCTAAACTATCCGTCAATCGCTGCATTGTTTTCAAGCTCAGCTACTGGAACGTCGA
                      ____________________________________________________________
consensus AGAATCTAAACTATCCGTCAATCGCTGCATTGTTTTCAAGCTCAGCTACTGGAACGTCGA
 
. : . : . : . : . : . :
rJMFF028I01+ CAGTGACAAATGTGGGGGAGACGAACGCAGTGTACAGGGTGA
rJMFF012L19+ GCAAGACATTCTTCAGGACAGTGACAAATGTGGGGGAGACGAACGCAGTGTACAGGGTGA
                      ____________________________________________________________
consensus GCAAGACATTCTTCAGGACAGTGACAAATGTGGGGGAGACGAACGCAGTGTACAGGGTGA
 
. : . : . : . : . : . :
rJMFF028I01+ AGGTCGAGGCACCCAAGGGAGTGAGCGTGAGTGTGAAGCCAATGAAGCTGGTGTTCTCGG
JMFS159C11- GAGTGAGCGTGAGTGTGAAGCCAATGAAGCTGGTGTTCTCGG
rJMFF012L19+ AGGTCGAGGCACCCAAGGGAGTGAGCGTGAGTGTGAAGCCAATGAAGCTGGTGTTCTCGG
                      ____________________________________________________________
consensus AGGTCGAGGCACCCAAGGGAGTGAGCGTGAGTGTGAAGCCAATGAAGCTGGTGTTCTCGG
 
. : . : . : . : . : . :
rJMFF028I01+ AGACAGTGAGGAAATTGAACTACTATGTGACAATCAGCATGGATAGCAAGAACGTGGTGT
JMFS159C11- AGACAGTGAGGAAATTGAACTACTATGTGACAATCAGCATGGATAGCAAGAACGTGGTGT
rJMFF012L19+ AGACAGTGAGGAAATTGAACTACTATGTGACAATCAGCATGGATAGCAAGAACGTGGTGT
                      ____________________________________________________________
consensus AGACAGTGAGGAAATTGAACTACTATGTGACAATCAGCATGGATAGCAAGAACGTGGTGT
 
. : . : . : . : . : . :
rJMFF028I01+ TGGATGATTCGGGTGCTGTTTTTGGTTCACTTTCTTGGACGGATGGGAAGCATGTGGTTC
JMFS159C11- TGGATGATTCGGGTGCTGTTTTTGGTTCACTTTCTTGGACGGATGGGAAGCATGTGGTTC
rJMFF012L19+ TGGATGATTCGGGTGCTGTTTTTGGTTCACTTTCTTGGACGGATGGGAAGCATGTGGTTC
                      ____________________________________________________________
consensus TGGATGATTCGGGTGCTGTTTTTGGTTCACTTTCTTGGACGGATGGGAAGCATGTGGTTC
 
. : . : . : . : . : . :
rJMFF028I01+ GAAGCATCATAACAGTGACCCAACTGGAGCCATTGTAGAAGACTGCAAATGCTGAATGCA
JMFS159C11- GAAGCATCATAACAGTGGCCCAACTGGAGCCATTGTAGAAGACTGCAAATGCTGAATGCA
rJMFF012L19+ GAAGCATCATAACAGTGACCCAACTGGAGCCATTGTAGAAGACTGCAAATGCTGAATGCA
                      ____________________________________________________________
consensus GAAGCATCATAACAGTGACCCAACTGGAGCCATTGTAGAAGACTGCAAATGCTGAATGCA
 
. : . : . : . : . : . :
rJMFF028I01+ TATGCATATGCATGCACCAGAAGTTGTTAAGGGTTATTAGCAGACAATGCAAGAAAGAAA
JMFS159C11- TATGCATATGCATGCACCAGAAGTTGTTAAGGGTTATTAGCAGACAATGCAAGAAAGAAA
rJMFF012L19+ TATGCATATGCATGCACCAGAAGTTGTTAAGGGTTATTAGCAGACAATGCAAGAAAGAAA
                      ____________________________________________________________
consensus TATGCATATGCATGCACCAGAAGTTGTTAAGGGTTATTAGCAGACAATGCAAGAAAGAAA
 
. : . : . : . : . : . :
rJMFF028I01+ TTAATTAATTAAAATAGATGAGAGATGAGAGATGAGATGGAGCATTGGAGCAGCTAGAAT
JMFS159C11- TTAATTAATTAAAATAGATGAGAGATGAGAGATGAGATGGAGCATTGGAGCAGCTAGAAT
rJMFF012L19+ TTAATTAATTAAAATAGATGAGAGATGAGAGATGAGATGGAGCATTGGAGCAGCTAGAAT
                      ____________________________________________________________
consensus TTAATTAATTAAAATAGATGAGAGATGAGAGATGAGATGGAGCATTGGAGCAGCTAGAAT
 
. : . : . : . : . : . :
rJMFF028I01+ GGTTGGTACCTATTATGTTTATGTAATGTAATGTAGTACTTAGATGGAGTGTGAAGTAGC
JMFS159C11- GGTTGGTACCTATTATGTTTATGTAATGTAATGTAGTACTTAGATGGAGTGTGAAGTANC
rJMFF012L19+ GGTTGGTACCTATTATGTTTATGTAATGTAATGTAGTACTTAGATGGAGTGTGAAGTAGC
                      ____________________________________________________________
consensus GGTTGGTACCTATTATGTTTATGTAATGTAATGTAGTACTTAGATGGAGTGTGAAGTAGC
 
. : . : . : . : . : . :
rJMFF028I01+ AGAAGTGTGCTGCTTGGTTGCTTGCTATGCCTAGATAGATTAGATAGCCTAAGCCGCTTC
JMFS159C11- AGAAGTGTGCTGCTTGGTTGCT
rJMFF012L19+ AGAAGTGTGCTGCTTGGTTGCTTGCTATGCCTAGATAGATTAGATAGCCTAAGCCGCTTC
                      ____________________________________________________________
consensus AGAAGTGTGCTGCTTGGTTGCTTGCTATGCCTAGATAGATTAGATAGCCTAAGCCGCTTC
 
. : . : . : . : . : . :
rJMFF028I01+ CTCCGACTCGGAGGAAGCTAGCATGCATGCAACCATTTTCCCTAGTCCTGTTTTGGTTTG
rJMFF012L19+ CTCCGACTCGGAGGAAGCTAGCATGCATGCAACCATTTTCCCTAGTCCTGTTTTGGTTTG
                      ____________________________________________________________
consensus CTCCGACTCGGAGGAAGCTAGCATGCATGCAACCATTTTCCCTAGTCCTGTTTTGGTTTG
 
. : . : . : . : . : . :
rJMFF028I01+ ATTTATTTTGTCGTGTGGAGTGCTATTATTTAGAAAGAAGTTAGTTGGTGGTAG
rJMFF012L19+ ATTTATTTTGTCGTGTGGAGTGCTATTATTTAGAAAGAAGTTAGTTGGTGGTAGTATAGT
                      ____________________________________________________________
consensus ATTTATTTTGTCGTGTGGAGTGCTATTATTTAGAAAGAAGTTAGTTGGTGGTAGTATAGT