Previous Contig 008781:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012K19Sequence507000665 (8)pir|A96715|A967151e-28protein F4N2.4 [imported] - Arabidopsis thaliana>gb:AE005173_894519 Arabidopsis 803008781 (6)gb:AC090874_17345604e-42Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb
JMSF026A14Sequence677000665 (8)pir|A96715|A967155e-33protein F4N2.4 [imported] - Arabidopsis thaliana>gb:AE005173_894519 Arabidopsis 753008781 (6)gb:AC090874_17345604e-35Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb
JMSF034G17Sequence683000665 (8)pir|A96715|A967152e-34protein F4N2.4 [imported] - Arabidopsis thaliana>gb:AE005173_894519 Arabidopsis 763008781 (6)gb:AC090874_17345603e-37Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb
JMSF035D19Sequence667000665 (8)gb:AC090874_17345609e-30Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb772008781 (6)gb:AC090874_17345602e-39Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb
JMSF041K02Sequence526000665 (8)gb:AC090874_17345603e-29Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb591008781 (6)gb:AC090874_17345603e-10Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb
JMSF044C23Sequence721000665 (8)gb:AC090874_17345602e-38Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb746008781 (6)gb:AC090874_17345605e-39Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035D19+ ATG
rJMSF034G17+ ATG
rJMFF012K19+ TTCATGCCAATCTTAAAGCTTTTGAATG
                      ____________________________________________________________
consensus TTCATGCCAATCTTAAAGCTTTTGAATG
 
. : . : . : . : . : . :
rJMSF035D19+ AACTGGCAGCACAGAATCATATGCCAGACATATTACAGGAGAAAATCAAGAATGTTATCC
rJMSF034G17+ AACTGGCAGCACAGAATCATATGCCAGACAT-TTACNGGAGAAAATCAAGAATGTTATCC
rJMSF044C23+ CACAGAATCATATGCCAGACATATTACAGGAGAAAATCAAGAATGTTATCC
rJMSF026A14+ CACAGAATCATATGCCAGACATATTACAGGAGAAAATCAAGAATGTTATCC
rJMFF012K19+ AACTGGCAGCACAGAATCATATGCCAGACATATTACAGGAGAAAATCAAGAATGTTATCC
                      ____________________________________________________________
consensus AACTGGCAGCACAGAATCATATGCCAGACATATTACAGGAGAAAATCAAGAATGTTATCC
 
. : . : . : . : . : . :
rJMSF035D19+ AACTAA-TTGAAAACCAAGTTGAGGAAAATCACAGGCTGCGTCAACCTCTAAGAATGAGG
rJMSF034G17+ AACTAA-TTGAAAACAAAGTTGAGGAAAATCACAGGCTGCGTCAACCTCTAAGAATGAGG
rJMSF044C23+ AACTAA-TTGAAAACAAAGTTGAGGAAAATCACAGGCTGCGTCAACCTCTAAGAATGAGG
rJMSF026A14+ AACTAATTTGAAAACAAAGTTGAGGAAAATCACAGGCTGCGTCAACCTCTAAGAATGAGG
rJMFF012K19+ AACTAA-TTGAAAACAAAGTTGAGGAAAATCACAGGCTGCGTCAACCTCTAAGAATGAGG
                      ____________________________________________________________
consensus AACTAA-TTGAAAACAAAGTTGAGGAAAATCACAGGCTGCGTCAACCTCTAAGAATGAGG
 
. : . : . : . : . : . :
rJMSF035D19+ AAGCAAAAGCCTGTGCCTATCAAGATGGTTAATCCCAAATTTGAAGACAACTTTATTAAG
rJMSF034G17+ AAGCAAAAGCCTGTGCCTATCAAGATGGTTAATCCCAAATTTGAAGACAACTTTATTAAG
rJMSF044C23+ AAGCAAAAGCCTGTGCCTATCAAGATGGTTAATCCCAAATTTGAAGACAACTTTATTAAG
rJMSF026A14+ AAGCAAAAGCCTGTGCCTATCAAGATGGTTAATCCCAAATTTGAAGACAACTTTATTAAG
rJMSF041K02+ AG
rJMFF012K19+ AAGCAAAAGCCTGTGCCTATCAAGATGGTTAATCCCAAATTTGAAGACAACTTTATTAAG
                      ____________________________________________________________
consensus AAGCAAAAGCCTGTGCCTATCAAGATGGTTAATCCCAAATTTGAAGACAACTTTATTAAG
 
. : . : . : . : . : . :
rJMSF035D19+ GGTAGAGATTATGACCCAGATCGTGAACGGGCTGAGATAAGGAAGTTAAAGAAACGCGTA
rJMSF034G17+ GGTAGAGATTATGACCCAGATCGTGAACGGGCTGAGATAAGGAAGTTAAAGAAACGCGTA
rJMSF044C23+ GGTAGAGATTATGACCCAGATCGTGAACGGGCTGAGATAAGGAAGTTAAAGAAACGCGTA
rJMSF026A14+ GGTAGAGATTATGACCCAGATCGTGAACGGGCTGAGATAAGGAAGTTAAAGAAACGCGTA
rJMSF041K02+ GGTAGAGATTANGACCCAGNTCGTGAACGGGCTGNGATAAGGAAGTTAAAGAANCGNGTA
rJMFF012K19+ GGTAGAGATTATGACCCAGATCGTGAACGGGCTGAGATAAGGAAGTTAAAGAAACGCGTA
                      ____________________________________________________________
consensus GGTAGAGATTATGACCCAGATCGTGAACGGGCTGAGATAAGGAAGTTAAAGAAACGCGTA
 
. : . : . : . : . : . :
rJMSF035D19+ AAACAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTAAAGATAATCATTTCTTGTTTGGG
rJMSF034G17+ AAACAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTAAAGATAATCATTTCTTGTTTGGG
rJMSF044C23+ AAACAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTAAAGATAATCATTTCTTGTTTGGG
rJMSF026A14+ AAACAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTAAAGATAATCATTTCTTGTTTGGG
rJMSF041K02+ AANCAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTNANGATANTCANTTCTTGTNTGGG
rJMFF012K19+ AAACAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTAAAGATAATCATTTCTTGTTTGGG
                      ____________________________________________________________
consensus AAACAGGAAGCGAAAGGAGCTGCTCGTGAAATTCGTAAAGATAATCATTTCTTGTTTGGG
 
. : . : . : . : . : . :
rJMSF035D19+ GTGAAGGAGAAGGAGAAAGCAGCTCTAGCAGAAGAAAGGTCTGAAAAGTATGGGAAAGCG
rJMSF034G17+ GTGAAGGAGAAGGAGAAAGCAGCTCTAGCAGAAGAAAGGTCTGAAAAGTATGGGAAAGCG
rJMSF044C23+ GTGAAGGAGAAGGAGAAAGCAGCTCTAGCAGAAGAAAGGTCTGAAAAGTATGGGAAAGCG
rJMSF026A14+ GTGAAGGAGAAGGAGAAAGCAGCTCTAGCAGAAGAAAGGTCTGAAAAGTATGGGAAAGCG
rJMSF041K02+ GCGANGGAGAAGGAGAAAGCAGCTNTAGCAGANGAAAGGTCTGAAANGTATGGNANAGCG
rJMFF012K19+ GTGAAGGAGAAGGAGAAAGCAGCTCTAGCAGAAGAAAGGTCTGAAAAGTATGGGAAAGCG
                      ____________________________________________________________
consensus GTGAAGGAGAAGGAGAAAGCAGCTCTAGCAGAAGAAAGGTCTGAAAAGTATGGGAAAGCG
 
. : . : . : . : . : . :
rJMSF035D19+ CTTGCTTTTCTTCAAGAACAAGAGCACGCATTTAAATCTGGGCAATTGGGAGGAAACAGG
rJMSF034G17+ CTTGCTTTTCTTCAAGAACAAGAGCACGCATTTAAATCTGGGCAATTGGGAGGAAACAGG
rJMSF044C23+ CTTGCTTTTCTTCAAGAACAAGAGCACGCATTTAAATCTGGGCAATTGGGAGGAAACAGG
rJMSF026A14+ CTTGCTTTTCTTCAAGAACAAGAGCACGCATTTAAATCTGGGCAATTGGGAGGAAACAGG
rJMSF041K02+ CCTGCTTTTCTTCAAGANCNAGAGCNCGCATTNANATCNGGGCNATTGGGAGGAAACAGG
rJMFF012K19+ CTTGCTTTTCTTCAAGAACAAGAGCACGCATTTAAATCTGGGCAATTGGGAGGAAACAGG
                      ____________________________________________________________
consensus CTTGCTTTTCTTCAAGAACAAGAGCACGCATTTAAATCTGGGCAATTGGGAGGAAACAGG
 
. : . : . : . : . : . :
rJMSF035D19+ AAGAGAAGAAGATGAAGAAATTCAACTCACAGTTTCATTCTGGCCTGGATTACTTGAAAA
rJMSF034G17+ AAGAGAAGAAGATGAAGAAATTCAACTCACAGTTTCATTCTGGCCTGGATTACTTGAAAA
rJMSF044C23+ AAGAGAAGAAGATGAAGAAATTCAACTCACAGTTTCATTCTGGCCTGGATTACTTGAAAA
rJMSF026A14+ AAGAGAAGAAGATGAAGAAATTCAACTCACAGTTTCATTCTGGCCTGGATTACTTGAAAA
rJMSF041K02+ AAGAGAAGAAGANGAAGAAATTCAACTCACNGTTTCATTCTGGCNTGGNTTACTTGAAAA
rJMFF012K19+ AAGAGAAGAAGATGAAGAAATTCAACTCACAGTTTCATTCTGGCCTGGATTACTTGAAAA
                      ____________________________________________________________
consensus AAGAGAAGAAGATGAAGAAATTCAACTCACAGTTTCATTCTGGCCTGGATTACTTGAAAA
 
. : . : . : . : . : . :
rJMSF035D19+ TTCTGGTGAGTATATCTGCACTTTATTATACTCCTTGCTGATACCATACGGAGAAGATAA
rJMSF034G17+ TTCTGGTGAGTATATCTGCACTTTATTATACTCCTTGCTGATACCATACGGAGAAGATAA
rJMSF044C23+ TTCTGGTGAGTATATCTGCACTTTATTATACTCCTTGCTGATACCATACGGAGAAGATAA
rJMSF026A14+ TTCTGGTGAGTATATCTGCACTTTATTATACTCCTTGCTGATACCATACGGAGAAGATAA
rJMSF041K02+ TTCTGGTGAGTATATCNNCACTTTNTTATACTCCTNGCTGNNACCATGCGGAGAAGNTAA
rJMFF012K19+ TTCTGGTGAGTATATCTGCACTTTATTATACTCCTTGCTGATACCATACGGAGAAGATAA
                      ____________________________________________________________
consensus TTCTGGTGAGTATATCTGCACTTTATTATACTCCTTGCTGATACCATACGGAGAAGATAA
 
. : . : . : . : . : . :
rJMSF035D19+ CACTGATTCCATGCTTTAATTTGCCCTTTCACAATCCATTCATGTGAGAGGTATGAAGTT
rJMSF034G17+ CACTGATTCCATGCTTTAATTTGCCCTTTCACAATCCATTCATGTGAGAGGTATGAAGTT
rJMSF044C23+ CACTGATTCCATGCTTTAATTTGCCCTTTCACAATCCATTCATGTGAGAGGTATGAAGTT
rJMSF026A14+ CACTGATTCCATGCTTTAATTTGCCCTTTCACAATCCATTCATGTGAGAGGTATGAAGTT
rJMSF041K02+ CNCTGATNCCATGCTTTACTTTGCCCTTTCNCAATCCATTCANGTGAGAGGTANNAAGTT
rJMFF012K19+ CACTGATTCCATGCTTTAATTTGCCCTTTCACAATCCATTCATGTGAGAGGTATGAAGTT
                      ____________________________________________________________
consensus CACTGATTCCATGCTTTAATTTGCCCTTTCACAATCCATTCATGTGAGAGGTATGAAGTT
 
. : . : . : . : . : . :
rJMSF035D19+ CAACTAGCTTAACTGTACTAGTGCAGCTGAATCTGTATGTGTTGCACTTTTTATTTGTAG
rJMSF034G17+ CAACTAGCTTAACTGTACTAGTGCAGCTGAATCTGTATGTGTTGCACTTTTTATTTGTAG
rJMSF044C23+ CAACTAGCTTAACTGTACTAGTGCAGCTGAATCTGTATGTGTTGCACTTTTTATTTGTAG
rJMSF026A14+ CAACTAGCTTAACTGTACTAGTGCAGCTGAATCTGTATGTGTTGCACTTTTTATTTGTAG
rJMSF041K02+ CAACTAGCTTATCTGTACTAGTGCAGCTGNNTCCGTATGTGTTGCNCCTTNTATTTGTAG
rJMFF012K19+ CAACTAGCTTAACTGTACTAGTGCAGCTGAATCTGTATGTGTTGCACTTTTTATTTGTAG
                      ____________________________________________________________
consensus CAACTAGCTTAACTGTACTAGTGCAGCTGAATCTGTATGTGTTGCACTTTTTATTTGTAG
 
. : . : . : . : . : . :
rJMSF035D19+ TAGT--AGTGTATTA-GTTATCAAGAAATCAAGAATCAAGAACACCATATATACAAGAGT
rJMSF034G17+ TAGT--AGTGTATTA-GTTATCAAGAAATCAAGAATCAAGAACACCATATATACAAGAGT
rJMSF044C23+ TAGT--AGTGTATTA-GTTATCAAGAAATCAAGAATCAAGAACACCATATATACAAGAGT
rJMSF026A14+ TAGT--AGTGTATTA-GTTATCAAGAAATCAAGAATCAAGAACACCATATATACAAGAGT
rJMSF041K02+ TAGCTCAGTGTNTTACGTTATCANGAAATCAAGAATCAAGAACACCATATATACAAGCGT
rJMFF012K19+ TAGT--AGTGTATTA-GTTATCAAGAAATCAAGAATCAAGAACACCATATATACAAGAGT
                      ____________________________________________________________
consensus TAGT--AGTGTATTA-GTTATCAAGAAATCAAGAATCAAGAACACCATATATACAAGAGT
 
. : . : . : . : . : . :
rJMSF035D19+ GGAGTTGAGGGAAAGTATAAAAATT-CATGTAAAGTGTT
rJMSF034G17+ GGAGTTGAGGGAAAGTATAAAAATT-CATGTAAAGTGTT
rJMSF044C23+ GGAGTTGAGGGAAAGTATAAAAATT-CATGTAAAGTGTT
rJMSF026A14+ GGAGTTGAGGGAAAGTATAAAAATT-CATGTAAAGTGTTG
rJMSF041K02+ GGAGTTGAGGGAAAGTATAAAAATTACATGTAAAGTGT
rJMFF012K19+ GGAGTTGAGGGAAAGTATAAAAATT-CATGTAAAGTGTTTGAATGTTTGGGCCACAAAAT
                      ____________________________________________________________
consensus GGAGTTGAGGGAAAGTATAAAAATT-CATGTAAAGTGTTTGAATGTTTGGGCCACAAAAT