Previous Contig 008778:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012J08Sequence511008778 (2)pir|G86253|G862536e-60hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890205 Arabid708008778 (2)pir|G86253|G862533e-52hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890205 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF012J08- ATCTTCA
                      ____________________________________________________________
consensus ATCTTCA
 
. : . : . : . : . : . :
JMFF012J08- CCTTCCGGCCTTAACCATTATCTATGGCTTCTTCCCCATCTTTCATCGCCGCCATTTTTC
                      ____________________________________________________________
consensus CCTTCCGGCCTTAACCATTATCTATGGCTTCTTCCCCATCTTTCATCGCCGCCATTTTTC
 
. : . : . : . : . : . :
JMFF012J08- TGTTCTTCTCCCCATTTCTGCAGCTCGCAAAATCTCACGAAAATGTCTGCAGAAAATGGT
                      ____________________________________________________________
consensus TGTTCTTCTCCCCATTTCTGCAGCTCGCAAAATCTCACGAAAATGTCTGCAGAAAATGGT
 
. : . : . : . : . : . :
JMFF012J08- GTGGAGACATTCCTATTCAGTACCCTTTGGGCATCGACGACGGCTGCGGCAGCCCATACT
                      ____________________________________________________________
consensus GTGGAGACATTCCTATTCAGTACCCTTTGGGCATCGACGACGGCTGCGGCAGCCCATACT
 
. : . : . : . : . : . :
JMFF012J08- ACCGCCACATTATCACCTGCACCGCCGGCGACCTGCAGCTCCGGACACCGTCCGGGAGGT
                      ____________________________________________________________
consensus ACCGCCACATTATCACCTGCACCGCCGGCGACCTGCAGCTCCGGACACCGTCCGGGAGGT
 
. : . : . : . : . : . :
JMFF012J08- ACCCGATAAAGAACGTGAGCTATTCCGACCCGCACATTCTGGTAACTGATCCGTTCATGT
                      ____________________________________________________________
consensus ACCCGATAAAGAACGTGAGCTATTCCGACCCGCACATTCTGGTAACTGATCCGTTCATGT
 
. : . : . : . : . : . :
JMFF012J08- GGAGCTGCGAGGACGGCGAGGATTTCAGGCCGACGAGGCCGTTCAGCCTGGACACGAGCA
                      ____________________________________________________________
consensus GGAGCTGCGAGGACGGCGAGGATTTCAGGCCGACGAGGCCGTTCAGCCTGGACACGAGCA
 
. : . : . : . : . : . :
JMFF012J08- CCCACTTGAGCCTCTCGCCGCAGAACGATTATCTGTTCTTCAACTGCAGCGGCGAGAAGG
                      ____________________________________________________________
consensus CCCACTTGAGCCTCTCGCCGCAGAACGATTATCTGTTCTTCAACTGCAGCGGCGAGAAGG
 
. : . : . : . : . : . :
JMFF012J08- TGATCGTGGAGCCGAAGCCGGCGTTCTGCGAGCGCTTCCCGGAGCAGTGCGACTCGACGT
rJMFF012J08+ CGAAGCCGGCGTTTTGCGAGCGCTTCCCGGAGCAGTGCGACTCGACGT
                      ____________________________________________________________
consensus TGATCGTGGAGCCGAAGCCGGCGTTTTGCGAGCGCTTCCCGGAGCAGTGCGACTCGACGT
 
. : . : . : . : . : . :
JMFF012J08- GCGACAGCGCCAGTTTCCTGTGCC
rJMFF012J08+ GCGACAGCGCCAGTTTCCTGTGCCGCCACCTGCCGGAGTGCCCCTCCGCCCTGCGCGGCG
                      ____________________________________________________________
consensus GCGACAGCGCCAGTTTCCTGTGCCGCCACCTGCCGGAGTGCCCCTCCGCCCTGCGCGGCG
 
. : . : . : . : . : . :
rJMFF012J08+ GCAGCTCCTGCTGCTNGTACTACCCCAAGGCGGCGGAGTCGCTGAGGCTGATGCTGCGCC
                      ____________________________________________________________
consensus GCAGCTCCTGCTGCTNGTACTACCCCAAGGCGGCGGAGTCGCTGAGGCTGATGCTGCGCC
 
. : . : . : . : . : . :
rJMFF012J08+ ACTGCGCGTCGTACACGGGGGTGTACTGGCGGAACCTGGACGCCACGCCGGCGTTTAACC
                      ____________________________________________________________
consensus ACTGCGCGTCGTACACGGGGGTGTACTGGCGGAACCTGGACGCCACGCCGGCGTTTAACC
 
. : . : . : . : . : . :
rJMFF012J08+ AGGTGCCGGAGTACGGCGTCCGGGTGGACTTCGATATTTCCGGTGACGGCGAAGTGCTTG
                      ____________________________________________________________
consensus AGGTGCCGGAGTACGGCGTCCGGGTGGACTTCGATATTTCCGGTGACGGCGAAGTGCTTG
 
. : . : . : . : . : . :
rJMFF012J08+ GAGTGCCAAGATGTTACTAAGGGCGGCGGGACGTGTGGGTTTGATATTGAGACGCAGGAT
                      ____________________________________________________________
consensus GAGTGCCAAGATGTTACTAAGGGCGGCGGGACGTGTGGGTTTGATATTGAGACGCAGGAT
 
. : . : . : . : . : . :
rJMFF012J08+ TTNTTGTGTATTTGTGACAAAGGCAACAGCNCCNCTAATTGCTTTGATACTCGGCACAAG
                      ____________________________________________________________
consensus TTNTTGTGTATTTGTGACAAAGGCAACAGCNCCNCTAATTGCTTTGATACTCGGCACAAG
 
. : . : . : . : . : . :
rJMFF012J08+ ATGTCCAAAGTAGTAGCAGCTACAGCAGTATCAGTGGCAGGGGCAATTGGATTAGGAGCA
                      ____________________________________________________________
consensus ATGTCCAAAGTAGTAGCAGCTACAGCAGTATCAGTGGCAGGGGCAATTGGATTAGGAGCA
 
. : . : . : . : . : . :
rJMFF012J08+ GGAGTTTGGTACCTAAGAAGAGTGAGAGCAAAAGCTCCCGTCACACATGGTGTTCAGACA
                      ____________________________________________________________
consensus GGAGTTTGGTACCTAAGAAGAGTGAGAGCAAAAGCTCCCGTCACACATGGTGTTCAGACA
 
. : . : . : . : . : . :
rJMFF012J08+ AACGATAATCGACTTTTTTAATATGGACTTTTTTTCTTTAACTTCCTTTTTAAGGTATCA
                      ____________________________________________________________
consensus AACGATAATCGACTTTTTTAATATGGACTTTTTTTCTTTAACTTCCTTTTTAAGGTATCA
 
. : . : . : . : . : . :
rJMFF012J08+ AGTNTNTTACGCTCGTGAACATTGTTGAGGTTGACAAGCCGTCAATCCCGGAGTGGTTTA
                      ____________________________________________________________
consensus AGTNTNTTACGCTCGTGAACATTGTTGAGGTTGACAAGCCGTCAATCCCGGAGTGGTTTA
 
. : . : . : . : . : . :
rJMFF012J08+ GTTCTTCTCTTGTAGTTATTTTTTACTCTTTTCTTGTATCAATAAAATAAAAAAAAAAAT
                      ____________________________________________________________
consensus GTTCTTCTCTTGTAGTTATTTTTTACTCTTTTCTTGTATCAATAAAATAAAAAAAAAAAT