Previous Contig 008776:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012I22Sequence588000661 (6)gb:OSJN00181_16962871e-21Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081G05, complete seque801008776 (5)gb:AE016959_10234326e-14Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMFF016L12Sequence570000661 (6)gb:OSJN00181_16962871e-21Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081G05, complete seque722008776 (5)gb:AE016959_10234325e-14Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMFF039N18Sequence582000661 (6)gb:AC087425_17340493e-21Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete seq721008776 (5)gb:AE016959_10234325e-14Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF033B15Sequence633000661 (6)gb:AC087425_17340494e-18Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete seq746008776 (5)gb:AE016959_10234326e-18Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF048L18Sequence694000661 (6)gb:AC087425_17340494e-24Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete seq801008776 (5)gb:AE016959_10234323e-17Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048L18+ TGTGCAATGTGAAGATGAGTCCTGTTCTATGCTT
                      ____________________________________________________________
consensus TGTGCAATGTGAAGATGAGTCCTGTTCTATGCTT
 
. : . : . : . : . : . :
rJMSF048L18+ TTGTGAGTTGTTCTCTAGCCCAGAAATGCTGGGATTTATTTGAGCACACTATTCCCCATC
                      ____________________________________________________________
consensus TTGTGAGTTGTTCTCTAGCCCAGAAATGCTGGGATTTATTTGAGCACACTATTCCCCATC
 
. : . : . : . : . : . :
rJMSF048L18+ ATTGTGTATCTTTTATGGATTGGGTTGAGTTACAGTTTAATAGTTTGTCAGATAATGAGC
                      ____________________________________________________________
consensus ATTGTGTATCTTTTATGGATTGGGTTGAGTTACAGTTTAATAGTTTGTCAGATAATGAGC
 
. : . : . : . : . : . :
rJMSF048L18+ TATGCAAGTTGATATCTATTTGCTGGAAAGTTTGGGATGCTAGAAATGAGAAGGTCTGGA
                      ____________________________________________________________
consensus TATGCAAGTTGATATCTATTTGCTGGAAAGTTTGGGATGCTAGAAATGAGAAGGTCTGGA
 
. : . : . : . : . : . :
rJMSF048L18+ ATAATATTGTGATTTCTTCCCATGATGTTGTCTCAGGTGCTTTATCCTACTTGTTGGAGT
rJMFF039N18+ CAGGTGCTTTATCCTACTTGTTGGAGT
rJMFF016L12+ CAGGTGCTTTATCCTACTTGTTGGAGT
rJMSF033B15+ CAGGTGCTTTATCCTACTTGTTGGAGT
rJMFF012I22+ CAGGTGCTTTATCCTACTTGTTGGAGT
                      ____________________________________________________________
consensus ATAATATTGTGATTTCTTCCCATGATGTTGTCTCAGGTGCTTTATCCTACTTGTTGGAGT
 
. : . : . : . : . : . :
rJMSF048L18+ GGCAATCTGCCAATCAGCTCAGCCACCACCAATCCCATGTTTCCCATCAGGTTGAAACTT
rJMFF039N18+ GGCAATCTGCCAATCAGCTCAGCCACCACCAATCCCATGTTTCCCATCAGGTTGAAACTT
rJMFF016L12+ GGCAATCTGCCAATCAGCTCAGCCACCACCAATCCCATGTTTCCCATCAGGTTGAAACTT
rJMSF033B15+ GGCAATCTGCCAATCAGCTCAGCCACCACCAATCCCATGTTTCCCATCAGGTTGAAACTT
rJMFF012I22+ GGCAATCTGCCAATCAGCTCAGCCACCACCAATCCCATGTTTCCCATCAGGTTGAAACTT
                      ____________________________________________________________
consensus GGCAATCTGCCAATCAGCTCAGCCACCACCAATCCCATGTTTCCCATCAGGTTGAAACTT
 
. : . : . : . : . : . :
rJMSF048L18+ GGTCAAAACCTCTAGTGGGGTGGCTCAAACTCAATAGTGATGAAGCTTTGGATTCAAATA
rJMFF039N18+ GGTCAAAACCTCTAGTGGGGTGGCTCAAACTCAATAGTGATGAAGCTTTGGATTCAAATA
rJMFF016L12+ GGTCAAAACCTCTAGTGGGGTGGCTCAAACTCAATAGTGATGAAGCTTTGGATTCAAATA
rJMSF033B15+ GGTCAAAACCTCTAGTGGGGTGGCTCAAACTCAATAGTGATGAAGCTTTGGATTCAAATA
rJMFF012I22+ GGTCAAAACCTCTAGTGGGGTGGCTCAAACTCAATAGTGATGAAGCTTTGGATTCAAATA
                      ____________________________________________________________
consensus GGTCAAAACCTCTAGTGGGGTGGCTCAAACTCAATAGTGATGAAGCTTTGGATTCAAATA
 
. : . : . : . : . : . :
rJMSF048L18+ GCAGGTGAATGGGGATGGGCCTTGTGCTTTGGGATGCATATGGTCAATTTGTGGCTGCGA
rJMFF039N18+ GCAGGTGAATGGGGATGGGCCTTGTGCTTTGGGATGCATATGGTCAATTTGTGGCTGCGA
rJMFF016L12+ GCAGGTGAATGGGGATGGGCCTTGTGCTTTGGGATGCATATGGTCAATTTGTGGCTGCGA
rJMSF033B15+ GCAGGTGAATGGGGATGGGCCTTGTGCTTTGGGATGCATATGGTCAATTTGTGGCTGCGA
rJMFF012I22+ GCAGGTGAATGGGGATGGGCCTTGTGCTTTGGGATGCATATGGTCAATTTGTGGCTGCGA
                      ____________________________________________________________
consensus GCAGGTGAATGGGGATGGGCCTTGTGCTTTGGGATGCATATGGTCAATTTGTGGCTGCGA
 
. : . : . : . : . : . :
rJMSF048L18+ AATCTATTCCCTGGGATGGTCTATGCTTACCTATGGAGGCAGAAGCTATTGCTATAAGAG
rJMFF039N18+ AATCTATTCCCTGGGATGGTCTATGCTTACCTATGGAGGCAGAAGCTATTGCTATAAGAG
rJMFF016L12+ AATCTATTCCCTGGGATGGTCTATGCTTACCTATGGAGGCAGAAGCTATTGCTATAAGAG
rJMSF033B15+ AATCTATTCCCTGGGATGGTCTATGCTTACCTATGGAGGCAGAAGCTATTGCTATAAGAG
rJMFF012I22+ AATCTATTCCCTGGGATGGTCTATGCTTACCTATGGAGGCAGAAGCTATTGCTATAAGAG
                      ____________________________________________________________
consensus AATCTATTCCCTGGGATGGTCTATGCTTACCTATGGAGGCAGAAGCTATTGCTATAAGAG
 
. : . : . : . : . : . :
rJMSF048L18+ AAGCGCTGAAGTGGTTAAAATCTTTGCAATTGGACAAGGTTCAGATTGAATCCGATTGCA
rJMFF039N18+ AAGCGCTGAAGTGGTTAAAATCTTTGCAATTGGACAAGGTTCAGATTGAATCCGATTGCA
rJMFF016L12+ AAGCGCTGAAGTGGTTAAAATCTTTGCAATTGGACAAGGTTCAGATTGAATCCGATTGCA
rJMSF033B15+ AAGCGCTGAAGTGGTTAAAATCTTTGCAATTGGACAAGGTTCAGATTGAATCCGATTGCA
rJMFF012I22+ AAGCGCTGAAGTGGTTAAAATCTTTGCAATTGGACAAGGTTCAGATTGAATCCGATTGCA
                      ____________________________________________________________
consensus AAGCGCTGAAGTGGTTAAAATCTTTGCAATTGGACAAGGTTCAGATTGAATCCGATTGCA
 
. : . : . : . : . : . :
rJMSF048L18+ TTAAAGTCATCCAAGCAATTAACAGCACTAGTTTATGTTCTTCTTTTGATTTGATTATCA
rJMFF039N18+ TTAAAGTCATCCAAGCAATTAACAGCACTAGTTTATGTTCTTCTTTTGATTTGATTATCA
rJMFF016L12+ TTAAAGTCATCCAAGCAATTAACAGCACTAGTTTATGTTCTTCTTTTGATTTGATTATCA
rJMSF033B15+ TTAAAGTCATCCAAGCAATTAACAGCACTAGTTTATGTTCTTCTTTTGATTTGATTATCA
rJMFF012I22+ TTAAAGTCATCCAAGCAATTAACAGCACTAGTTTATGTTCTTCTTTTGATTTGATTATCA
                      ____________________________________________________________
consensus TTAAAGTCATCCAAGCAATTAACAGCACTAGTTTATGTTCTTCTTTTGATTTGATTATCA
 
. : . : . : . : . : . :
rJMSF048L18+ ACGATATTAGGGAGATAGCTAGAGACTTTACTAATCTCAGCTTTCATTTTGTTAAACGGT
rJMFF039N18+ ACGATATTAGGGAGATAGCTAGAGACTTTACTAATCTCAGCTTTCATTTTGTTAAACGGT
rJMFF016L12+ ACGATATTAGGGAGATAGCTAGAGACTTTACTAATCTCAGCTTTCATTTTGTTAAACGGT
rJMSF033B15+ ACGATATTAGGGAGATAGCTAGAGACTTTACTAATCTCAGCTTTCATTTTGTTAAACGGT
rJMFF012I22+ ACGATATTAGGGAGATAGCTAGAGACTTTACTAATCTCAGCTTTCATTTTGTTAAACGGT
                      ____________________________________________________________
consensus ACGATATTAGGGAGATAGCTAGAGACTTTACTAATCTCAGCTTTCATTTTGTTAAACGGT
 
. : . : . : . : . : . :
rJMSF048L18+ CTGCGAGCAAGGTTGCTCATGAGCTTGCTCGGGAAGCCATGTTCAAGGCTGACTGTATGG
rJMFF039N18+ CTGCGAACAAGGTTGCTCATGAGCTTGCTCGGGAAGCCATGTTCAAGGCTGACTGTATGG
rJMFF016L12+ CTGCGAACAAGGTTGCTCATGAGCTTGCTCGGGAAGCCATGTTCAAGGCTGACTGTATGG
rJMSF033B15+ CTGCGAACAAGGTTGCTCATGAGCTTGCTCGGGAAGCCATGTTTAAGGCTGACTGTATGG
rJMFF012I22+ CTGCGAACAAGGTTGCTCATGAGCTTGCTCGGGAAGCCATGTTCAAGGCTGACTGTATGG
                      ____________________________________________________________
consensus CTGCGAACAAGGTTGCTCATGAGCTTGCTCGGGAAGCCATGTTCAAGGCTGACTGTATGG
 
. : . : . : . : . : . :
rJMSF048L18+ TCTGTGTTTCGGTTCCTTTTCCCTTGTATTGCTCATAGTCT
rJMFF039N18+ TCTGTGTTTCGGTTCCTTTT-CCTTGTATTGCTCATAGTCTTGAGCTTGACTTTTATTAA
rJMFF016L12+ TCTGTGTTTCGGTTCCTTTT-CCTTGTATTGCTCATAGTCT
rJMSF033B15+ TCTGTGTTTCGGTTCCTTTT-CCTTGTATTGCTCATAGTCT
rJMFF012I22+ TCTGTGTTTCGGTTCCTTTT-CCTTGTATTGCTCATAGTCTTGAGCTTGACTTTTATTAA
                      ____________________________________________________________
consensus TCTGTGTTTCGGTTCCTTTT-CCTTGTATTGCTCATAGTCTTGAGCTTGACTTTTATTAA