Previous Contig 008771:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012G13Sequence510008771 (6)gb:LES19104_16844861e-76Lycopersicon esculentum mRNA for beta-alanine synthase.720008771 (6)gb:LES19104_16844866e-75Lycopersicon esculentum mRNA for beta-alanine synthase.
JMFF030H01Sequence444008771 (6)gb:LES19104_16844864e-59Lycopersicon esculentum mRNA for beta-alanine synthase.736008771 (6)gb:LES19104_16844862e-89Lycopersicon esculentum mRNA for beta-alanine synthase.
JMFF046O02Sequence600008771 (6)gb:LES19104_16844861e-84Lycopersicon esculentum mRNA for beta-alanine synthase.548008771 (6)gb:LES19104_16844867e-53Lycopersicon esculentum mRNA for beta-alanine synthase.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030H01- GACTCTGCTTTGATTTCAT
JMFF046O02- ATTGACTCTGCTTTGATTTCAT
                      ____________________________________________________________
consensus ATTGACTCTGCTTTGATTTCAT
 
. : . : . : . : . : . :
JMFF012G13- GGTTAACGCAAGAGATTTAAGCACAAGGAGTTTAGCGGCGGAGAATGGCGGAGATC
JMFF030H01- TGTTGGTTAACGCAAGAGATTTAAGCACAAGGAGTTTAGCGGCGGAGAATGGCGGAGATC
JMFF046O02- TGTTGGTTAACGCAAGAGATTTAAGCACAAGGAGTTTAGCGGCGGAGAATGGCGGAGATC
                      ____________________________________________________________
consensus TGTTGGTTAACGCAAGAGATTTAAGCACAAGGAGTTTAGCGGCGGAGAATGGCGGAGATC
 
. : . : . : . : . : . :
JMFF012G13- AAGAGACTAGTCACCGTCGCAGCTCTGCAATTCGCCTGCACGGATGATGTCGCCACCAAC
JMFF030H01- AAGAGACTAGTCACCGTCGCAGCTCTGCAATTCGCCTGCACGGATGATGTCGCCACCAAC
JMFF046O02- AAGAGACTAGTCACCGTCGCAGCTCTGCAATTCGCCTGCACGGATGATGTCGCCACACAC
                      ____________________________________________________________
consensus AAGAGACTAGTCACCGTCGCAGCTCTGCAATTCGCCTGCACGGATGATGTCGCCACCAAC
 
. : . : . : . : . : . :
JMFF012G13- GTCGCCACCGCCGAGAGGTTGGTTAGAGAAGCTCATGAGAAGGGGGCGAATATCATTCTT
JMFF030H01- GTCGCCACCGCCGAGAGGTTGGTTAGAGAAGCTCATGAGAAGGGGGCGAATATCATTCTT
JMFF046O02- GTCGCCACCGCCGAGAGGTTGGTTAGAGAAGCTCATGAGAAGGGGGCGAATATCATTCTT
                      ____________________________________________________________
consensus GTCGCCACCGCCGAGAGGTTGGTTAGAGAAGCTCATGAGAAGGGGGCGAATATCATTCTT
 
. : . : . : . : . : . :
JMFF012G13- ATACAGGAGTTGTTTGAGGGTTATTACTTTTGTCAAGCACAAAGAGAAGACTACTTTCAA
JMFF030H01- ATACAGGAGTTGTTTGAGGGTTATTACTTTTGTCAAGCACAAAGAGAAGACTACTTTCAA
JMFF046O02- ATACAGGAGTTGTTTGAGGGTTATTACTTTTGTCAAGCACAAAGAGAAGACTACTTTCAA
                      ____________________________________________________________
consensus ATACAGGAGTTGTTTGAGGGTTATTACTTTTGTCAAGCACAAAGAGAAGACTACTTTCAA
 
. : . : . : . : . : . :
JMFF012G13- AGAGCAAAACCATACAAGGGACATCCAACAATACTAAGGATGCAGGAGCTTGCAAAAGAT
JMFF030H01- AGAGCAAAACCATACAAGGGACATCCAACAATACTAAGGATGCAGGAGCTTGCAAAAGAT
JMFF046O02- AGAGCAAAACCATACAAGGGACATCCAACAATACTAAGGATGCAGGAGCTTGCAAAAGAT
                      ____________________________________________________________
consensus AGAGCAAAACCATACAAGGGACATCCAACAATACTAAGGATGCAGGAGCTTGCAAAAGAT
 
. : . : . : . : . : . :
JMFF012G13- TTGGGAGTTGTAATTCCAGTTAGCTTCTTTGAGGAGGCAAATAATGCCCATTACAATTCA
JMFF030H01- TTGGGAGTTGTAATTCCAGTTAGCTTCTTTGAGGAGGCAAATAATGCCCATTACAATTCA
JMFF046O02- TTGGGAGTTGTAATTCCAGTTAGCTTCTTTGAGGAGGCAAATAATGCCCATTACAATTCA
                      ____________________________________________________________
consensus TTGGGAGTTGTAATTCCAGTTAGCTTCTTTGAGGAGGCAAATAATGCCCATTACAATTCA
 
. : . : . : . : . : . :
JMFF012G13- GTAGTTGTGATTGATGCTGATGGGACTGATCTTGGACTTTACAGAAAATCCCATATTCCT
JMFF030H01- GTANTTGTGATTGATGCTGATGGGACTGATCTTGGACTTTACAGAAAATCCCATATTCCT
JMFF046O02- GTAGTTGTGATTGATGCTGATGGGACTGATCTTGGACTTTACAGAANATCCCATATTCCT
rJMFF030H01+ ATCCCATATTCCT
                      ____________________________________________________________
consensus GTAGTTGTGATTGATGCTGATGGGACTGATCTTGGACTTTACAGAAAATCCCATATTCCT
 
. : . : . : . : . : . :
JMFF012G13- GATGGTCCAGGTTACCAGGAAAAATTTTACTTTAATCCAGGTGACACTGGCTTTAAGGTC
JMFF030H01- GATGG
JMFF046O02- GATGGTCCAGGTTACCAGGAAAAATTTTACTTTAATCCAGGTGACACTGGCTTTAAGGTC
rJMFF030H01+ GATGGTCCAGGTTACCAGGAAAAATTTTACTTTAATCCAGGTGACACTGGCTTTAAGGTC
                      ____________________________________________________________
consensus GATGGTCCAGGTTACCAGGAAAAATTTTACTTTAATCCAGGTGACACTGGCTTTAAGGTC
 
. : . : . : . : . : . :
JMFF012G13- TTCGAGACGAAATTTGCAAAAATTGGAGTGGGTA
JMFF046O02- TTCGAGACGAAATTTGCAAAAATTGGAGTGGGTATTTGCTGGGATCAATGGTTCCCCGA-
rJMFF030H01+ TTCGAGACGAAATTTGCAAAAATTGGAGTGGGTATTTGCTGGGATCAATGGTTCCCCGAG
rJMFF012G13+ TTCGAGACGAAATTTGCAAAAATTGGAGTGGGTATTTGCTGGGATCAATGGTTCCCCGAG
                      ____________________________________________________________
consensus TTCGAGACGAAATTTGCAAAAATTGGAGTGGGTATTTGCTGGGATCAATGGTTCCCCGAG
 
. : . : . : . : . : . :
JMFF046O02- GCAGCTCGAGCTATGGCTCTTCAGGGTGCAGAAATACTG
rJMFF030H01+ GCAGCTCGAGCTATGGCTCTTCAGGGTGCAGAAATACTGTTGTACCCAACTGCAATTGGT
rJMFF046O02+ CCAACTGCAA-TGGT
rJMFF012G13+ GCAGCTCGAGCTATGGCTCTTCAGGGTGCAGAAATACTGTTGTACCCAACTGCAATTGGT
                      ____________________________________________________________
consensus GCAGCTCGAGCTATGGCTCTTCAGGGTGCAGAAATACTGTTGTACCCAACTGCAATTGGT
 
. : . : . : . : . : . :
rJMFF030H01+ TCTGAACCTCAAGATGACGGACTTGATTCCCGAGAGCATTGGAAGCGAGTGATGCAAGGT
rJMFF046O02+ TCTGAACCTCAAGATGACGGACTTGATTCCCGAGAGCATTGGAAGCGAGTGATGCAAGGT
rJMFF012G13+ TCTGAACCTCAAGATGACGGACTTGATTCCCGAGAGCATTGGAAGCGAGTGATGCAAGGT
                      ____________________________________________________________
consensus TCTGAACCTCAAGATGACGGACTTGATTCCCGAGAGCATTGGAAGCGAGTGATGCAAGGT
 
. : . : . : . : . : . :
rJMFF030H01+ CATGCTGGGTCTAACGTAGTACCTCTAGTAGCTTCAAACCGCATTGGGAAGGAGATAATT
rJMFF046O02+ CATGCTGGGGCTAACGTAGTACCTCTAGTAGCTTCAAACCGCATTGGGAAGGAGATAATT
rJMFF012G13+ CATGCTGGGGCTAACGTAGTACCTCTAGTAGCTTCAAACCGCATTGGGAAGGAGATAATT
                      ____________________________________________________________
consensus CATGCTGGGGCTAACGTAGTACCTCTAGTAGCTTCAAACCGCATTGGGAAGGAGATAATT
 
. : . : . : . : . : . :
rJMFF030H01+ GAGACAGAGCATGGGAAGAGTGAGATAACATTCTATGGCAATTCCTTCATAGCAGGTCCC
rJMFF046O02+ GAGACAGAGCATGGGAAGAGTGAGATAACATTCTATGGCAATTCCTTCATAGCAGGTCCC
rJMFF012G13+ GAGACAGAGCATGGGAAGAGTGAGATAACATTCTATGGCAATTCCTTCATAGCAGGTCCC
                      ____________________________________________________________
consensus GAGACAGAGCATGGGAAGAGTGAGATAACATTCTATGGCAATTCCTTCATAGCAGGTCCC
 
. : . : . : . : . : . :
rJMFF030H01+ ACAGGAGAAATTGTGGCACTCGCAGATGATAAGCAGGAAGCTGTTCTTGTAGCACAGTTT
rJMFF046O02+ ACAGGAGAAATTGTGGCACTCGCAGATGATAAGCAGGAAGCTGTTCTTGTAGCACAGTTT
rJMFF012G13+ ACAGGAGAAATTGTGGCACTCGCAGATGATAAGCAGGAAGCTGTTCTTGTAGCACAGTTT
                      ____________________________________________________________
consensus ACAGGAGAAATTGTGGCACTCGCAGATGATAAGCAGGAAGCTGTTCTTGTAGCACAGTTT
 
. : . : . : . : . : . :
rJMFF030H01+ GATCTTGCCAATATCAAAAGCAAAAGACGTAGTTGGGGGGTGTTTCGTGATCGGCGCCCG
rJMFF046O02+ GATCTTGCCAATATCAAAAGCAAAAGACGTAGTTGGGGGGTGTTTCGTGATCGGCGCCCG
rJMFF012G13+ GATCTTGCCAATATCAAAAGCAAAAGACGTAGTTGGGGGGTGTTTCGTGATCGGCGCCCG
                      ____________________________________________________________
consensus GATCTTGCCAATATCAAAAGCAAAAGACGTAGTTGGGGGGTGTTTCGTGATCGGCGCCCG
 
. : . : . : . : . : . :
rJMFF030H01+ GAGTTGAATAAGGTGCTTTTGACATTAGATGGCCACAATCCATCTCTCTGAACTGAATTC
rJMFF046O02+ GAGTTGTATAAGGTGCTTTTGACATTAGATGGCCACAATCCATCTCTCTGAACTGAATTC
rJMFF012G13+ GAGTTGTATAAGGTGCTTTTGACATTAGATGGCCACAATCCATCTCTCTGAACTGAATTC
                      ____________________________________________________________
consensus GAGTTGTATAAGGTGCTTTTGACATTAGATGGCCACAATCCATCTCTCTGAACTGAATTC
 
. : . : . : . : . : . :
rJMFF030H01+ CTCAGTTAGTTTCTGGTTTGAGAGAGATGGTTGTAAGGAACTTTTAGAACCTCAAAATTT
rJMFF046O02+ CTCAGTTAGTTTCTGGTTTGAGAGAGATGGTTGTAAGGAACTTTTAGAACCTCAAAATTT
rJMFF012G13+ CTCAGTTAGTTTCTGGTTTGAGAGAGATGGTTGTAAGGAACTTTTAGAACCTCAAAATTT
                      ____________________________________________________________
consensus CTCAGTTAGTTTCTGGTTTGAGAGAGATGGTTGTAAGGAACTTTTAGAACCTCAAAATTT
 
. : . : . : . : . : . :
rJMFF030H01+ CATCTATACCATTTGAATAAGTAGATGGTTTAGCTCTAAGGTGCTATGTCCCTAGAAGAA
rJMFF046O02+ CATCTATACCATTTGAATAAGTAGATGGTTTAGCTCTAAGGTGCTATGTCCCTAGAAGAA
rJMFF012G13+ CATCTATACCATTTGAATAAGTAGATGGTTTAGCTCTAAGGTGCTATGTCCCTAGAAGAA
                      ____________________________________________________________
consensus CATCTATACCATTTGAATAAGTAGATGGTTTAGCTCTAAGGTGCTATGTCCCTAGAAGAA
 
. : . : . : . : . : . :
rJMFF030H01+ ACCGAGAAGAGATGTTTTGTTGTGGTCAATCACATTCAAGTATCTTCATATTATGATATC
rJMFF046O02+ ACCGAGAAGAGATGTTTTGTTGTGG
rJMFF012G13+ ACCGAGAAGAGATGTTTTGTTGTGGTCAATCACATTCAAGTATCTTCATATTATGATATC
                      ____________________________________________________________
consensus ACCGAGAAGAGATGTTTTGTTGTGGTCAATCACATTCAAGTATCTTCATATTATGATATC
 
. : . : . : . : . : . :
rJMFF030H01+ AA
rJMFF012G13+ AATACCAACATTTAGCTTCCAAATTTCATCTTCAACCGTTGTTTACATCTAAAAGTAAAG
                      ____________________________________________________________
consensus AATACCAACATTTAGCTTCCAAATTTCATCTTCAACCGTTGTTTACATCTAAAAGTAAAG