Previous Contig 008763:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001J08Sequence611008763 (7)567008763 (7)
JMFF012D21Sequence525008763 (7)742008763 (7)
JMFF027N07Sequence613008763 (7)692008763 (7)
JMFN020O23Sequence436008763 (7)gb:PFAHRPA_13937923e-04P.lophurae histidine-rich protein mRNA, 3' end.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027N07- CTTATTATATTATTAAGGATT
rJMFF012D21- ACTTATTATATTATTAAGGATT
                      ____________________________________________________________
consensus ACTTATTATATTATTAAGGATT
 
. : . : . : . : . : . :
rJMFF027N07- TGAGTGCGGACAAATACATATTACCATTAATCCTTGTATCCAATCTACTAGTCATGGATA
rJMFF001J08- CTTGTATCCAATCTACTAGTCATGGATA
rJMFF012D21- TGAGTGCGGACAAATACATATTACCATTAATCCTTGTATCCAATCTACTAGTCATGGATA
                      ____________________________________________________________
consensus TGAGTGCGGACAAATACATATTACCATTAATCCTTGTATCCAATCTACTAGTCATGGATA
 
. : . : . : . : . : . :
rJMFF027N07- TTATTTTGGTAAGAAAATTGGTAAAACTCCTTAAATTGAGGTAGCCAAAATGGAGACATT
JMFF027N07+ ATTGAGGTAGCCAAAATGGAGACATT
JMFF001J08+ TCCTTAAATTGAGGTAGCCAAAATGGAGACATT
rJMFF001J08- TTATTTTGGTAAGAAAATTGGTAAAACTCCTTAAATTGAGGTAGCCAAAATGGAGACATT
rJMFF012D21- TTATTTTGGTAAGAAAATTGGTAAAACTCCTTAAATTGAGGTAGCCAAAATGGAGACATT
                      ____________________________________________________________
consensus TTATTTTGGTAAGAAAATTGGTAAAACTCCTTAAATTGAGGTAGCCAAAATGGAGACATT
 
. : . : . : . : . : . :
rJMFF027N07- TAGCAGCCAACCCATGTTGATGGGATGAAGGTAGGTGTCATGGTTACACTCATCTGCTTT
JMFF027N07+ TAGCAGCCAACCCATGTTGATGGGATGAAGGTAGGTGTCATGGTTACACTCATCTGCTTT
JMFF001J08+ TAGCAGCCAACCCATGTTGATGGGATGAAGGTAGGTGTCATGGTTACACTCATCTGCTTT
rJMFF001J08- TAGCAGCCAACCCATGTTGATGGGATGAAGGTAGGTGTCATGGTTACACTCATCTGCTTT
rJMFF012D21- TAGCAGCCAACCCATGTTGATGGGATGAAGGTAGGTGTCATGGTTACACTCATCTGCTTT
                      ____________________________________________________________
consensus TAGCAGCCAACCCATGTTGATGGGATGAAGGTAGGTGTCATGGTTACACTCATCTGCTTT
 
. : . : . : . : . : . :
rJMFF027N07- TTATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTCTACGAACCAAAT
JMFF027N07+ TTATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTCTACGAACCAAAT
JMFF001J08+ TTATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTCTACGAACCAAAT
rJMFF001J08- TTATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTCTACGAACCAAAT
JMFF012D21+ ATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTNTACGAACCAAAT
rJMFF012D21- TTATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTCTACGAACCAAAT
                      ____________________________________________________________
consensus TTATGTCGTCGTCCTTGTCATTGTCATAAATAATATCTTCATCACTTCTACGAACCAAAT
 
. : . : . : . : . : . :
rJMFF027N07- CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
JMFF027N07+ CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
JMFN020O23+ TCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTT-ATCATCAC
JMFF001J08+ CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
rJMFF001J08- CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
JMFF012D21+ CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
rJMFF012D21- CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
                      ____________________________________________________________
consensus CTTCATCACTATTACCAATGCCATCTTCATCACTGTGACCAACCAAATCTTCATCATCAC
 
. : . : . : . : . : . :
rJMFF027N07- CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
JMFF027N07+ CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
JMFN020O23+ CGCCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
JMFF001J08+ CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
rJMFF001J08- CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
JMFF012D21+ CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
rJMFF012D21- CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
                      ____________________________________________________________
consensus CACCGCCATCTTCATGACTGTTACCAACCAAATCTTCATCACCGCCGCCATCTTTATGAC
 
. : . : . : . : . : . :
rJMFF027N07- TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
JMFF027N07+ TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
JMFN020O23+ TGTTACCAACCAAATGTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
JMFF001J08+ TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
rJMFF001J08- TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
JMFF012D21+ TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
rJMFF012D21- TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
                      ____________________________________________________________
consensus TGTTACCAACCAAATCTTCATCATCACCACCGCCATCTTCATGACTGTTACCAACCAAAT
 
. : . : . : . : . : . :
rJMFF027N07- CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
JMFF027N07+ CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
JMFN020O23+ CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
JMFF001J08+ CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
rJMFF001J08- CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
JMFF012D21+ CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
rJMFF012D21- CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
                      ____________________________________________________________
consensus CTTCATCACCGCCGCCATCTTCATCACTATTACCAACCATATCTTCATTTTTTACTTTCA
 
. : . : . : . : . : . :
rJMFF027N07- TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
JMFF027N07+ TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
JMFN020O23+ TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
JMFF001J08+ TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
rJMFF001J08- TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
JMFF012D21+ TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
rJMFF012D21- TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
                      ____________________________________________________________
consensus TGTTTCCTTCCCCACCCTTTAGGGGGGAATGTAAAGGCTCATCACTTTTAGTATCAACAA
 
. : . : . : . : . : . :
rJMFF027N07- CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTAGGGCTGAGCTAA
JMFF027N07+ CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTAGGGCTGAGCTAA
JMFN020O23+ CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTAGGGCTGAGCTAA
JMFF001J08+ CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTAGGGCTGAGCTAA
rJMFF001J08- CTCCTTCACCCAAACTACTTAATGTG
JMFF012D21+ CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTAGGGCTGAGCTAA
rJMFF012D21- CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTANGGCTGAGCTAA
                      ____________________________________________________________
consensus CTCCTTCACCCAAACTACTTAATGTGGGAGAGGGAAGGGGTCGACTTAGGGCTGAGCTAA
 
. : . : . : . : . : . :
rJMFF027N07- TAAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGGAAACACTTTTTGAAGATG
JMFF027N07+ TAAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGGAAACACTTTTTGAAGATG
JMFN020O23+ TAAGGGATGATAGAATTAGTAGAAGCATGAAAGCCGCCAT-GAAACACTTTTTGAAGATG
JMFF001J08+ TAAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGGAAACACTTTTTGAAGATG
JMFF012D21+ TAAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGGAAACACTTTTTGAAGATG
rJMFF012D21- TAAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGGAAACACTTTTTGAAGATG
                      ____________________________________________________________
consensus TAAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGGAAACACTTTTTGAAGATG
 
. : . : . : . : . : . :
rJMFF027N07- CCATAATGTTC
JMFF027N07+ CCATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGA
JMFN020O23+ CCATAATGTTCAGTAGTA
JMFF001J08+ CCATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATT
JMFF012D21+ CCATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGA
rJMFF012D21- CCATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGATCGGTTCTCGACGA
                      ____________________________________________________________
consensus CCATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGATCGGTTCTCGACGA