Previous Contig 008750:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012B06Sequence505004770 (2)765008750 (2)gb:AC134344_17417474e-86Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complet
JMSF006B19Sequence353005702 (20)gb:AY456411_16071863e-46Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.332008750 (2)gb:AC134344_17417473e-33Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012B06+ CGTGGATCAACTTTAAGTTGGCCTCTCCGAATGAAAATTGCTTTG
                      ____________________________________________________________
consensus CGTGGATCAACTTTAAGTTGGCCTCTCCGAATGAAAATTGCTTTG
 
. : . : . : . : . : . :
rJMFF012B06+ GATATTGCAAGAGGATTAGAATACCTTCACGAGCGTTGCAACCCCCCTGTGATCCATAGG
                      ____________________________________________________________
consensus GATATTGCAAGAGGATTAGAATACCTTCACGAGCGTTGCAACCCCCCTGTGATCCATAGG
 
. : . : . : . : . : . :
rJMFF012B06+ CATCTCAAATCGTCTAATATTCTTCTTGATTCCAGCTTCAACGCAAAGATTTCTGATTTT
                      ____________________________________________________________
consensus CATCTCAAATCGTCTAATATTCTTCTTGATTCCAGCTTCAACGCAAAGATTTCTGATTTT
 
. : . : . : . : . : . :
rJMFF012B06+ GGCCTTTCTGTAACTGGCGGAAACCTAAGCAAGAACATAACCAAGATTTCGGGATCACTG
                      ____________________________________________________________
consensus GGCCTTTCTGTAACTGGCGGAAACCTAAGCAAGAACATAACCAAGATTTCGGGATCACTG
 
. : . : . : . : . : . :
rJMFF012B06+ GGTTATCTTGCTCCAGAGTATCTCTTAGACGGTAAACTAACTGATAAGAGTGATGTGTAT
                      ____________________________________________________________
consensus GGTTATCTTGCTCCAGAGTATCTCTTAGACGGTAAACTAACTGATAAGAGTGATGTGTAT
 
. : . : . : . : . : . :
rJMFF012B06+ GGTTTTGGCATTATTCTTCTAGAGCTTTTGATGGGTAAAAGGCCAGTGGAGAAAGTGGGA
                      ____________________________________________________________
consensus GGTTTTGGCATTATTCTTCTAGAGCTTTTGATGGGTAAAAGGCCAGTGGAGAAAGTGGGA
 
. : . : . : . : . : . :
rJMFF012B06+ GAAACTAAGTGCCAATCAATAGTTACATGGGCTATGCCCCAGCTTACGGACCGATCAAAG
                      ____________________________________________________________
consensus GAAACTAAGTGCCAATCAATAGTTACATGGGCTATGCCCCAGCTTACGGACCGATCAAAG
 
. : . : . : . : . : . :
rJMSF006B19+ GATCAGAAACACAATGGATGTTAAGCATTTATATCAG
rJMFF012B06+ CTTCCGAATATTGTTGACCCTACGATCAGGAACACAATGGATGTTAAGCATTTATATCAG
                      ____________________________________________________________
consensus CTTCCGAATATTGTTGACCCTACGATCAGGAACACAATGGATGTTAAGCATTTATATCAG
 
. : . : . : . : . : . :
rJMSF006B19+ GTTGCGGCTGTAGCTGTGTTATGTGTGCAACCGGAGCCAAGCTATAGGCCATTGATAAC
rJMFF012B06+ GTTGCGGCTGTAGCTGTGTTATGTGTGCAACCGGAGCCAAGCTATAGGCCATTGATAACT
                      ____________________________________________________________
consensus GTTGCGGCTGTAGCTGTGTTATGTGTGCAACCGGAGCCAAGCTATAGGCCATTGATAACT
 
. : . : . : . : . : . :
rJMFF012B06+ GATGTACTACACTCCTTCATTCCACTTGTACCAAATGAACTCGGGGGGTCGCTTAGGGTA
                      ____________________________________________________________
consensus GATGTACTACACTCCTTCATTCCACTTGTACCAAATGAACTCGGGGGGTCGCTTAGGGTA
 
. : . : . : . : . : . :
rJMFF012B06+ GTGGATTCTACTCCCCATTGCTCATAGGAGTCATAGTTGTACCATACTTTGTATTCCCAA
                      ____________________________________________________________
consensus GTGGATTCTACTCCCCATTGCTCATAGGAGTCATAGTTGTACCATACTTTGTATTCCCAA
 
. : . : . : . : . : . :
rJMFF012B06+ AAGGATTGAAAATCAATGGAAGATCTTGTGTTTCCTGTATTCTTGGTTACAGATCTCCCA
                      ____________________________________________________________
consensus AAGGATTGAAAATCAATGGAAGATCTTGTGTTTCCTGTATTCTTGGTTACAGATCTCCCA
 
. : . : . : . : . : . :
rJMFF012B06+ AATGTGGTTTTTTGCTATGTGTTTAGAGTAGTGACACATGACAATGATATCTGTTGCTTT
                      ____________________________________________________________
consensus AATGTGGTTTTTTGCTATGTGTTTAGAGTAGTGACACATGACAATGATATCTGTTGCTTT