Previous Contig 008744:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005C17Sequence485008744 (8)gb:ATH506746_15528214e-55Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara726008744 (8)gb:ATH506746_15528211e-82Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara
JMFF012A04Sequence586008744 (8)gb:ATH506746_15528218e-68Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara676008744 (8)gb:ATH506746_15528218e-71Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara
JMFF019P08Sequence575008744 (8)gb:ATH506746_15528212e-51Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara665008744 (8)gb:ATH506746_15528211e-81Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara
JMSF026G10Sequence654008744 (8)gb:OSJN00067_16942283e-79Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0056F09, complete seque726008744 (8)gb:ATH506746_15528212e-84Arabidopsis thaliana mRNA for PEPINO protein (pep gene).>gb:AY047708_1561657 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019P08- TCTTCCGTG
                      ____________________________________________________________
consensus TCTTCCGTG
 
. : . : . : . : . : . :
JMFF019P08- CAGTTGATCGAAAGATGGAGTGACAGATGGCGAGTTGGTGATCCGTTCACCTACAAATTA
                      ____________________________________________________________
consensus CAGTTGATCGAAAGATGGAGTGACAGATGGCGAGTTGGTGATCCGTTCACCTACAAATTA
 
. : . : . : . : . : . :
JMFF019P08- AATACTCCGATATTATTTAATTAGAAATTGCAAACACCCAATTCATATTTCTTCGTTTCT
JMFF005C17- ATATTTCTTCGTTTCT
JMFF012A04- ATTGCAAACACCCAATTCATATTTCTTCGTTTCT
JMSF026G10- GTTTCT
                      ____________________________________________________________
consensus AATACTCCGATATTATTTAATTAGAAATTGCAAACACCCAATTCATATTTCTTCGTTTCT
 
. : . : . : . : . : . :
JMFF019P08- TCCGCTCATCTCAACTGAGCTGAGGTTTCAATTTCAAGCACGCCTTCTTCGATGGCGGGT
JMFF005C17- TCCGCTCATCTCAACTGAGCTGAGGTTTCAATTTCAAGCACGCCTTCTTCGATGGCGGGT
JMFF012A04- TCCGCTCATCTCAACTGAGCTGAGGTTTCAATTTCAAGCACGCCTTCTTCGATGGCGGGT
JMSF026G10- TCCGCTCATCTCAACTGAGCTGAGGTTTCAATTTCAAGCACGCCTTCTTCGATGGCGGGT
                      ____________________________________________________________
consensus TCCGCTCATCTCAACTGAGCTGAGGTTTCAATTTCAAGCACGCCTTCTTCGATGGCGGGT
 
. : . : . : . : . : . :
JMFF019P08- GGAGTTTTTTCAGGCTTGAGGCGCTTCTACCTCGCCCTTTACAATTGGGTTGTGTTTGTA
JMFF005C17- GGAGTTTTTTCAGGCTTGAGGCGCTTCTACCTCGCCCTTTACAATTGGGTTGTGTTTGTA
JMFF012A04- GGAGTTTTTTCAGGCTTGAGGCGCTTCTACCTCGCCCTTTACAATTGGGTTGTGTTTGTA
JMSF026G10- GGAGTTTTTTCAGGCTTGAGGCGCTTCTACCTCGCCCTTTACAATTGGGTTGTGTTTGTA
rJMFF019P08+ TTTACAATTGGGTTGTGTTTGTA
rJMSF026G10+ TTCTACCTCGCCCTTTACAATTGGGTTGTGTTTGTA
rJMFF005C17+ TTACAATTGGGTTGTGTTTGTA
                      ____________________________________________________________
consensus GGAGTTTTTTCAGGCTTGAGGCGCTTCTACCTCGCCCTTTACAATTGGGTTGTGTTTGTA
 
. : . : . : . : . : . :
JMFF019P08- GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
JMFF005C17- GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
JMFF012A04- GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGAATCTAATGGAGTCTGGGCACGAAAAT
JMSF026G10- GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
rJMFF019P08+ GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
rJMSF026G10+ GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
rJMFF005C17+ GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
rJMFF012A04+ GTCTGGGCACGAAAAT
                      ____________________________________________________________
consensus GGATGGGTTCAGGTGTTTTATCTTGCTGTGAAGACTCTAATGGAGTCTGGGCACGAAAAT
 
. : . : . : . : . : . :
JMFF019P08- GTCTACCAAGCCGTCTAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
JMFF005C17- GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
JMFF012A04- GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
JMSF026G10- GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
rJMFF019P08+ GTCTACCAAGCCGTCTAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
rJMSF026G10+ GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
rJMFF005C17+ GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
rJMFF012A04+ GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATNGGAGATA
                      ____________________________________________________________
consensus GTCTACCAAGCCGTCGAAAAGCCTCTGCTTTTAGCTCAATCCGCCGCCGTATTGGAGATA
 
. : . : . : . : . : . :
JMFF019P08- CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
JMFF005C17- CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
JMFF012A04- CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
JMSF026G10- CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
rJMFF019P08+ CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
rJMSF026G10+ CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
rJMFF005C17+ CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
rJMFF012A04+ CTTCATGGTNTAGTAGGACTNGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
                      ____________________________________________________________
consensus CTTCATGGTCTAGTAGGACTTGTGAGATCTCCTATTTCAGCAACACTGCCACAGATAGGA
 
. : . : . : . : . : . :
JMFF019P08- TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
JMFF005C17- TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
JMFF012A04- TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
JMSF026G10- TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
rJMFF019P08+ TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
rJMSF026G10+ TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
rJMFF005C17+ TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
rJMFF012A04+ TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
                      ____________________________________________________________
consensus TCGAGATTATATGTTACTTGGGGGATTTTGTATAGCTTTCCTGAGATTCGGACCCATGTA
 
. : . : . : . : . : . :
JMFF019P08- TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
JMFF005C17- TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
JMFF012A04- TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
JMSF026G10- TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
rJMFF019P08+ TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
rJMSF026G10+ TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
rJMFF005C17+ TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
rJMFF012A04+ TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
                      ____________________________________________________________
consensus TTTGTTAGTTCTCTAGTCATTAGTTGGTCTATCACAGAGATTATCCGGTATTCATTCTTT
 
. : . : . : . : . : . :
JMFF019P08- GGCACAAAGGAGGCATTTGGCCGTGG
JMFF005C17- GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTA
JMFF012A04- GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTANGTATAGCTCC
JMSF026G10- GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTAGGTATAGCTCC
rJMFF019P08+ GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTAGGTATAGCTCC
rJMSF026G10+ GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTAGGTATAGCTCC
rJMFF005C17+ GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTAGGTATAGCTCC
rJMFF012A04+ GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTAGGTATAGCTCC
                      ____________________________________________________________
consensus GGCACAAAGGAGGCATTTGGCCGTGGACCTTCAGGGCTCTTGTGGCTTAGGTATAGCTCC
 
. : . : . : . : . : . :
JMFF012A04- TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACNAGGCTCTT
JMSF026G10- TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACAAGGCTCTT
rJMFF019P08+ TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACAAGGCTCTT
rJMSF026G10+ TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACAAGGCTCTT
rJMFF005C17+ TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACAAGGCTCTT
rJMFF012A04+ TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACAAGGCTCTT
                      ____________________________________________________________
consensus TTCATCTTGCTATATCCTACCGGCATTACAAGTGAAGTTGGTTTAATATACAAGGCTCTT
 
. : . : . : . : . : . :
JMFF012A04- CCTTACCTCATG
JMSF026G10- CCTTACCTCATGGAATCGGGAAAGTATTCATTTTGGATGCCCAACAAATGGAACTTTTCT
rJMFF019P08+ CCTTACCTCATGGAATCGGGAAAGTATTCATTTTGGATGCCCAACAAATGGAACTTTTCT
rJMSF026G10+ CCTTACCTCATGGAATCGGGAAAGTATTCATTTTGGATGCCCAACAAATGGAACTTTTCT
rJMFF005C17+ CCTTACCTCATGGAATCGGGAAAGTATTCATTTTGGATGCCCAACAAATGGAACTTTTCT
rJMFF012A04+ CCTTACCTCATGGAATCGGGAAAGTATTCATTTTGGATGCCCAACAAATGGAACTTTTCT
                      ____________________________________________________________
consensus CCTTACCTCATGGAATCGGGAAAGTATTCATTTTGGATGCCCAACAAATGGAACTTTTCT
 
. : . : . : . : . : . :
JMSF026G10- TTCGACTACTACTACATGGCATTTGTTGTGTTGGCCATCTATGTTCC
rJMFF019P08+ TTCGACTACTACTACATGGCATTTGTTGTGTTGGCCATCTATGTTCCAGGCAGCCCTCAC
rJMSF026G10+ TTCGACTACTACTACATGGCATTTGTTGTGTTGGCCATCTATGTTCCAGGCAGCCCTCAC
rJMFF005C17+ TTCGACTACTACTACATGGCATTTGTTGTGTTGGCCATCTATGTTCCAGGCAGCCCTCAC
rJMFF012A04+ TTCGACTACTACTACATGGCATTTGTTGTGTTGGCCATCTATGTTCCAGGCAGCCCTCAC
                      ____________________________________________________________
consensus TTCGACTACTACTACATGGCATTTGTTGTGTTGGCCATCTATGTTCCAGGCAGCCCTCAC
 
. : . : . : . : . : . :
rJMFF019P08+ ATGTATGGCTACATGCTTGGACAAAGGAAGAAAGCTCTCCGCAAGGCCAAGCAGGCATAG
rJMSF026G10+ ATGTATGGCTACATGCTTGGACAAAGGAAGAAAGCTCTCCGCAAGGCCAAGCAGGCATAG
rJMFF005C17+ ATGTATGGCTACATGCTTGGACAAAGGAAGAAAGCTCTCCGCAAGGCCAAGCAGGCATAG
rJMFF012A04+ ATGTATGGCTACATGCTTGGACAAAGGAAGAAAGCTCTCCGCAAGGCCAAGCAGGCATAG
                      ____________________________________________________________
consensus ATGTATGGCTACATGCTTGGACAAAGGAAGAAAGCTCTCCGCAAGGCCAAGCAGGCATAG
 
. : . : . : . : . : . :
rJMFF019P08+ ACCACTGGCTTTATAACTTATGTGTTTGTATTTGGAATTTTG
rJMSF026G10+ ACCACTGGCTTTATAACTTATGTGTTTGTATTTGGAATTTTGGATGGATTCTTGTTTTTT
rJMFF005C17+ ACCACTGGCTTTATAACTTATGTGTTTGTATTTGGAATTTTGGATGGATTCTTGTTTTTT
rJMFF012A04+ ACCACTGGCTTTATAACTTATGTGTTTGTATTTGGAATTTTGGATGGATTCTTGTTTTTT
                      ____________________________________________________________
consensus ACCACTGGCTTTATAACTTATGTGTTTGTATTTGGAATTTTGGATGGATTCTTGTTTTTT
 
. : . : . : . : . : . :
rJMSF026G10+ TAAATCATTTCATCTTCATCTTTGGT
rJMFF005C17+ TAAATCATTTCATCTTCATCTTTGGTTGAACTATGC
rJMFF012A04+ TAAATCATTTCATCTTCATCTTTGGTTGAACTATGCNGAAAACAATGGTAGATTTCTCTC
                      ____________________________________________________________
consensus TAAATCATTTCATCTTCATCTTTGGTTGAACTATGCNGAAAACAATGGTAGATTTCTCTC