Previous Contig 008743:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011P22Sequence556003375 (6)sp|O24381|TLC1_SOLTU1e-39Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas755008743 (5)sp|O24381|TLC1_SOLTU2e-22Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMFF013G07Sequence614003375 (6)sp|O24381|TLC1_SOLTU1e-36Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas624008743 (5)sp|O24381|TLC1_SOLTU2e-52Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMFF035A24Sequence477001553 (11)pir|T02766|T027660.002adhesin WI-1 - Ajellomyces dermatitidis>gb:BDU37772_1632838 Ajellomyces dermatit637008743 (5)sp|O24381|TLC1_SOLTU2e-36Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas
JMSF005F18Sequence440000016 (73)sp|P77214|CUSF_ECOLI5e-54Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es392008743 (5)
JMSF039M19Sequence669003375 (6)sp|O24381|TLC1_SOLTU2e-62Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas750008743 (5)sp|O24381|TLC1_SOLTU2e-54Plastidic ATP/ADP-transporter.>pir|T07420|T07420 ATP/ADP-transporter, chloroplas

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013G07+ GGTGACCCACTAG
rJMSF039M19+ TGGTGACCCACTAG
                      ____________________________________________________________
consensus TGGTGACCCACTAG
 
. : . : . : . : . : . :
rJMFF013G07+ CACNTTCTCTTGCAAAGTTTGGGATGACCCNTCTCCTGGCAGCTGTGTTTGTGGGTGCAA
rJMSF039M19+ CACCTTCTCTTGCAAAGTTTGGGATGACCCCTCTCCTGGCAGCTGTGTTTGTGGGTGCAA
                      ____________________________________________________________
consensus CACCTTCTCTTGCAAAGTTTGGGATGACCCCTCTCCTGGCAGCTGTGTTTGTGGGTGCAA
 
. : . : . : . : . : . :
rJMFF013G07+ TGCAGAACATTTTCAGTAAGAGTGCGAAATACAGCTTGTTTGATCCTTGCAAGGAAATGG
rJMSF039M19+ TGCAGAACATTTTCAGTAAGAGTGCGAAATACAGCTTGTTTGATCCTTGCAAGGAAATGG
rJMFF035A24+ AAGGAAATGG
                      ____________________________________________________________
consensus TGCAGAACATTTTCAGTAAGAGTGCGAAATACAGCTTGTTTGATCCTTGCAAGGAAATGG
 
. : . : . : . : . : . :
rJMFF013G07+ CATACATTCCTTTAGATGAAGACACCAAGGTTAAGGGAAAGGCAGCAATTGATGTTGTGT
rJMSF039M19+ CATACATTCCTTTAGATGAAGACACCAAGGTTAAGGGAAAGGCAGCAATTGATGTTGTGT
rJMFF035A24+ CATTCATTCCTTTAGATGAAGACACCAAGGTTAAGGGAAAGGCAGCAATTGATGTTGTGT
rJMFF011P22+ CCAAGGTTAANTGAAAGGCAGCAATTGATGTTGTGT
                      ____________________________________________________________
consensus CATACATTCCTTTAGATGAAGACACCAAGGTTAAGGGAAAGGCAGCAATTGATGTTGTGT
 
. : . : . : . : . : . :
rJMFF013G07+ GCAACCCATTGGGAAAGTCAGGGGGTGCTTTGATACAGCAATTCATGATTTTAAGTTTTG
rJMSF039M19+ GCAACCCATTGGGAAAGTCAGGGGGTGCTTTGATACAGCAATTCATGATTTTAAGTTTTG
rJMFF035A24+ GCAACCCATTGGGAAAGTCAGGGGGTGCTTTGATACAGCAATTCATGATTTTAAGTTTTG
rJMFF011P22+ GCAACCCATTGGGAAAGTCAGGGGGTGCTTTGATACAGCAATTCATGATTTTAAGTTTTG
                      ____________________________________________________________
consensus GCAACCCATTGGGAAAGTCAGGGGGTGCTTTGATACAGCAATTCATGATTTTAAGTTTTG
 
. : . : . : . : . : . :
rJMFF013G07+ GTTCTCTTGCTAACTCAACTCCCTACCTCGGAGGTGTTCTATTGGTGATTGTTGTTGCAT
rJMSF039M19+ GTTCTCTTGCTAACTCAACTCCCTACCTCGGAGGTGTTCTATTGGTGATTGTTGTTGCAT
rJMFF035A24+ GTTCTCTTGCTAACTGAACTCCCTACCTCGGAGGTGATCTATTGGTGATTGTTGTTGCAT
rJMFF011P22+ GTTCTCTTGCTAACTCAACTCCCTACCTCGGAGGTGTTCTATTGGTGATTGTTGTTGCAT
                      ____________________________________________________________
consensus GTTCTCTTGCTAACTCAACTCCCTACCTCGGAGGTGTTCTATTGGTGATTGTTGTTGCAT
 
. : . : . : . : . : . :
rJMFF013G07+ GGTTGGCGGCAGCAAGGTCGTTGGATGGGCAGTTCAGTGCGTTGAGGCAAGAAGAAGAGC
rJMSF039M19+ GGTTGGCGGCAGCAAGGTCGTTGGATGGGCAGTTCAGTGCGTTGAGGCAAGAAGAAGAGC
rJMFF035A24+ GGTTGGCGGCAGCAAGGTCGTTGGATGGGCAGTTCAGTGCGTTGAGGCAAGAAGAAGAGC
rJMSF005F18+ CAGTGCGTTGAGGCAAGAAGAAGAGC
rJMFF011P22+ GGTTGGCGGCAGCAAGGTCGTTGGATGGGCAGTTCAGTGCGTTGAGGCAAGAAGAAGAGC
                      ____________________________________________________________
consensus GGTTGGCGGCAGCAAGGTCGTTGGATGGGCAGTTCAGTGCGTTGAGGCAAGAAGAAGAGC
 
. : . : . : . : . : . :
rJMFF013G07+ TGGAGAAGGAGATGGAGCGATCAGCTGTGAAGAT-CCCTGTTGTGTCTCAAGATGGAAAT
rJMSF039M19+ TGGAGAAGGAGATGGAGCGATCAGCTGTGAAGAT-CCCTGTTGTGTCTCAAGATGGAAAT
rJMFF035A24+ TGGAGAAGGAGATGGAGCGATCAGCTGTGAAGAT-CCCTGTTGTGTCTCAAGATGGAAAT
rJMSF005F18+ TGGAGAAGGAGATGGAGCGATCAGCTGTGAAGATCCCCTGTTGTGTCTCAAGATGGAAAT
rJMFF011P22+ TGGAGAAGGAGATGGAGCGATCAGCTGTGAAGAT-CCCTGTTGTGTCTCAAGATGGAAAT
                      ____________________________________________________________
consensus TGGAGAAGGAGATGGAGCGATCAGCTGTGAAGAT-CCCTGTTGTGTCTCAAGATGGAAAT
 
. : . : . : . : . : . :
rJMFF013G07+ GGTTCTCTATACCCAGGAGGAGGCGACTCGGCTAGCGCTTCCTCTGAGCCCTCCTCTCAG
rJMSF039M19+ GGTTCTCTATACCCAGGAGGAGGCGACTCGGCTAGCGCTTCCTCTGAGCCCTCCTCTCAG
rJMFF035A24+ GGTTCTCTATACCCAGGAGGAGGCGACTCGGCTAGCGCTTCCTCTGAGCCCTCCTNTCAG
rJMSF005F18+ GGTTCTCTATACCCAGGAGGAGGCGACTCGGCTAGCGCTTCCTCTGAGCCCTCCTCTCAG
rJMFF011P22+ GGTTCTCTATACCCAGGAGGAGGCGACTCGGCTAGCGCTTCCTCTGAGCCCTCCTCTCAG
                      ____________________________________________________________
consensus GGTTCTCTATACCCAGGAGGAGGCGACTCGGCTAGCGCTTCCTCTGAGCCCTCCTCTCAG
 
. : . : . : . : . : . :
rJMFF013G07+ CGCCAGGTGTAAACAAGAAAAGGCTAGATATTATATCAACTATCAAGTGGATGGGGTATG
rJMSF039M19+ CGCCAGGTGTAAACAAGAAAAGGCTAGATATTATATCAACTATCAAGTGGATGGGGTATG
rJMFF035A24+ CGCCAGGTGTAAACAAGAAAAGGCTAGATATTATATCAACTATCAAGTGGATGGGGTATG
rJMSF005F18+ CGCCAGGTGTAAACAAGAAAAGGCTAGATATTATATCAACTATCAAGTGGATGGGGTATG
rJMFF011P22+ CGCCAGGTGTAAACAAGAAAAGGCTAGATATTATATCAACTATCAAGTGGATGGGGTATG
                      ____________________________________________________________
consensus CGCCAGGTGTAAACAAGAAAAGGCTAGATATTATATCAACTATCAAGTGGATGGGGTATG
 
. : . : . : . : . : . :
rJMFF013G07+ CATGTGTTGGTGTTAGGTGTAGCCATTGACCCTCGCTCGCTGGCTGGCTGGCTGGCTAGT
rJMSF039M19+ CATGTGTTGGTGTTAGGTGTAGCCATTGACCCTCGCTCGCTGGCTGGCTGGCTGGCTAGT
rJMFF035A24+ CATGTGTTGGTGTTAGGTGTAGCCATTGACCCTCGCTCGCTGGCTGGCTGGCTGGCTAGT
rJMSF005F18+ CATGTGTTGGTGTTAGGTGTAGCCATTGACCCTCGCTCGCTGGCTGGCTGGCTGGCTAGT
rJMFF011P22+ CATGTGTTGGTGTTAGGTGTAGCCATTGACCCTCGCTCGCTGGCTGGCTGGCTGGCTAGT
                      ____________________________________________________________
consensus CATGTGTTGGTGTTAGGTGTAGCCATTGACCCTCGCTCGCTGGCTGGCTGGCTGGCTAGT
 
. : . : . : . : . : . :
rJMFF013G07+ AGAAATAAAACA
rJMSF039M19+ AGAAATAAAACATGAATACAGATGGCTTTTACTGATTAGATTTAGTAGCAATTTGTTGTG
rJMFF035A24+ AGAAATAAAACATGAATACAGATGGCTTTTACTGATTAGATTTAGTAGCAATTTGTTGTG
rJMSF005F18+ AGAAATAAAACATGAATACAGATGGCTTTTACTGATTAGATTTAGTAGCAATTTGTTGTG
rJMFF011P22+ AGAAATAAAACATGAATACAGATGGCTTTTACTGATTAGATTTAGTAGCAATTTGTTGTG
                      ____________________________________________________________
consensus AGAAATAAAACATGAATACAGATGGCTTTTACTGATTAGATTTAGTAGCAATTTGTTGTG
 
. : . : . : . : . : . :
rJMSF039M19+ CTGGCTGGGAATCATAGTTGCAGAATTATTGTGTTTGTTGTAGTTACATACATACATACA
rJMFF035A24+ CTGGCTGGGAATCATAGTTGCAGGATTATTGTGTTTGTTGTAGTTACATACATACATACA
rJMSF005F18+ CTGGCTGGGAATCATAGTTGCAGAATTATTGTGTTTGTTGTAGTTACATACATACATACA
rJMFF011P22+ CTGGCTGGGAATCATAGTTGCAGAATTATTGTGTTTGTTGTAGTTACATACATACATACA
                      ____________________________________________________________
consensus CTGGCTGGGAATCATAGTTGCAGAATTATTGTGTTTGTTGTAGTTACATACATACATACA
 
. : . : . : . : . : . :
rJMSF039M19+ TACTGCCTCAA
rJMFF035A24+ TACTGCCTCAACTCAAGATCCAAATGCA
rJMSF005F18+ TACTGC
rJMFF011P22+ TACTGCCTCAACTCAAGATCCAAATGCAGGAGGTTGCGTTTCGATTGTTTGATCAAATTG
                      ____________________________________________________________
consensus TACTGCCTCAACTCAAGATCCAAATGCAGGAGGTTGCGTTTCGATTGTTTGATCAAATTG
 
. : . : . : . : . : . :
rJMFF011P22+ TGCCGTGTACTCTATCTAGCCCATACGCCTGACCCAAGATAATCTGGGAAGATGGCCAGA
                      ____________________________________________________________
consensus TGCCGTGTACTCTATCTAGCCCATACGCCTGACCCAAGATAATCTGGGAAGATGGCCAGA
 
. : . : . : . : . : . :
rJMFF011P22+ AAAAGTCAAACAAAGTATAGACACATACATAATATGTCAATTGTAATAGACATATAATTT
                      ____________________________________________________________
consensus AAAAGTCAAACAAAGTATAGACACATACATAATATGTCAATTGTAATAGACATATAATTT