Previous Contig 008738:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011O13Sequence351008738 (8)pir|G71410|G714101e-08probable protein kinase - Arabidopsis thaliana>gb:ATCHRIV39_1545242 Arabidopsis
JMFF029L02Sequence427005341 (3)gb:AC123513_11924107e-26Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN798008738 (8)gb:AB022223_15151754e-98Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155
JMFF033K17Sequence302014737732008738 (8)gb:AC120505_17397432e-87Oryza sativa chromosome 3 BAC OSJNBa0066H15 genomic sequence, complete sequence.
JMFF039H22Sequence336014862696008738 (8)gb:AC120505_17397433e-82Oryza sativa chromosome 3 BAC OSJNBa0066H15 genomic sequence, complete sequence.
JMFF041N19Sequence641005341 (3)gb:AC123513_11924102e-25Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN642008738 (8)gb:AB022223_15151752e-68Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155
JMSF012M06Sequence465005341 (3)gb:AC123513_11924108e-26Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN773008738 (8)gb:AB022223_15151757e-96Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155
JMSF048B04Sequence361020418367008738 (8)gb:AC120505_17397433e-60Oryza sativa chromosome 3 BAC OSJNBa0066H15 genomic sequence, complete sequence.
JMSF049B04Sequence148008738 (8)gb:AB022223_15151759e-18Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MWI23.>gb:AY035004_155

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012M06+ AAAAGAAGCTGGCGTTTAAGATTGTTATTCAACTTGCT
rJMFF029L02+ TTGTACAAAANCCGGAAAAAGAAGCTGGCGTTTAAGATTGTTATTCAACTTGCT
                      ____________________________________________________________
consensus TTGTACAAAANCCGGAAAAAGAAGCTGGCGTTTAAGATTGTTATTCAACTTGCT
 
. : . : . : . : . : . :
rJMSF012M06+ TNGGATCTTTCTCGAGGGTTGAGCTATTTACATTCCAAAAAAATAGTTCATCGCGATGTG
rJMFF039H22+ CATCGCGATGTG
rJMSF048B04+ CTCGAGGGTTGAGCTATTTACATTCCAAAAAAATAGTTCATCGCGATGTG
rJMFF029L02+ TTGGATCTTTCTCGAGGGTTGAGCTATTTACATTCCAAAAAAATAGTTCATCGCGATGTG
rJMFF033K17+ TTGAGCTATTTACATTCCAAAAAAATAGTTCATCGCGATGTG
                      ____________________________________________________________
consensus TTGGATCTTTCTCGAGGGTTGAGCTATTTACATTCCAAAAAAATAGTTCATCGCGATGTG
 
. : . : . : . : . : . :
rJMSF012M06+ AAAGCTGAAAACATGTTGCTGGATACTAGTCGAAATTTGAAAATCGCTGATTTCGGTGTG
rJMFF039H22+ AAAGCTGAAAACATGTTGCTGGATACTAGTCGAAATTTGAAAATCGCTGATTTCGGTGTG
rJMSF048B04+ AAAGCTGAAAACATGTTGCTGGATACTAGTCGAAATTTGAAAATCGCTGATTTCGGTGTG
rJMFF029L02+ AAAGCTGAAAACATGTTGCTGGATACTAGTCGAAATTTGAAAATCGCTGATTTCGGTGTG
rJMFF033K17+ AAAGCTGAAAACATGTTGCTGGATACTAGTCGAAATTTGAAAATCGCTGATTTCGGTGTG
                      ____________________________________________________________
consensus AAAGCTGAAAACATGTTGCTGGATACTAGTCGAAATTTGAAAATCGCTGATTTCGGTGTG
 
. : . : . : . : . : . :
rJMSF012M06+ GCTCGTGTTGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
rJMFF039H22+ GCTCGTGTTGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
rJMSF048B04+ GCTCGTGTTGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
rJMFF029L02+ GCTCGTGTTGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
rJMFF033K17+ GCTCGTGTTGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
rJMFF041N19+ TGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
                      ____________________________________________________________
consensus GCTCGTGTTGAAGCACAGAATCCAAAGGACATGACGGGTGAAACTGGTACCCTTGGGTAC
 
. : . : . : . : . : . :
rJMSF012M06+ ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
rJMFF039H22+ ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
rJMSF048B04+ ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
rJMSF049B04+ TGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
rJMFF029L02+ ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
rJMFF033K17+ ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
rJMFF041N19+ ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
                      ____________________________________________________________
consensus ATGGCCCCAGAGGTTCTTGATGGCAAGCCCTATAACAGAAAATGCGATGTATACAGCTTC
 
. : . : . : . : . : . :
rJMSF012M06+ GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
rJMFF039H22+ GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
rJMSF048B04+ GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
rJMSF049B04+ GGGGTNTGCTTGNGGGAAATTTACTGCTGTGATTTNCCATATCCAGATCTGAGCNNTGCT
rJMFF029L02+ GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
rJMFF033K17+ GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
rJMFF041N19+ GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
                      ____________________________________________________________
consensus GGGGTTTGCTTGTGGGAAATTTACTGCTGTGATTTGCCATATCCAGATCTGAGCTTTGCT
 
. : . : . : . : . : . :
rJMSF012M06+ GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGATGTTGCCCG
rJMFF039H22+ GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGATGTTGCCCG
rJMSF048B04+ GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGNNGTTGCCCG
rJMSF049B04+ GAAGTATCTTNTGCGGNTGNTAGACAGAA
rJMFF029L02+ GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGATGTTGCCCG
rJMFF033K17+ GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGATGTTGCCCG
rJMFF041N19+ GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGATGTTGCCCG
                      ____________________________________________________________
consensus GAAGTTTCTTCTGCGGTTGTTAGACAGAATCTCCGCCCAGAAATTCCCAGATGTTGCCCG
 
. : . : . : . : . : . :
rJMSF012M06+ AGTTCCTTAGCCAGCATCATGAAGAAATGCTGGGATGCGAATCCAGACAAGCGACCTGAA
rJMFF039H22+ AGTTCCTTAGCCAGCATCATGAAGAAATGCTGGGATGCGAATCCAGACAAGCGACCTGAA
rJMSF048B04+ AGTTCNTTAGCCAGCAT
rJMFF029L02+ AGTTCCTTAGCCAGCATCATGAAGAAATGCTGGGATGCGAATCCAGACAAGCGACCTGAA
rJMFF033K17+ AGTTCCTTAGCCAGCATCATGAAGAAATGCTGGGATGCGAATCCAGACAAGCGACCTGAA
rJMFF041N19+ AGTTCCTTAGCCAGCATCATGAAGAAATGCTGGGATGCGAATCCAGACAAGCGACCTGAA
                      ____________________________________________________________
consensus AGTTCCTTAGCCAGCATCATGAAGAAATGCTGGGATGCGAATCCAGACAAGCGACCTGAA
 
. : . : . : . : . : . :
rJMSF012M06+ ATGGACGAAGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
rJMFF039H22+ ATGGACGAAGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
rJMFF029L02+ ATGGACGAAGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
rJMFF033K17+ ATGGACGAAGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
rJMFF041N19+ ATGGACGAAGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
rJMFF011O13+ AGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
                      ____________________________________________________________
consensus ATGGACGAAGTAGTGAGGTTGATGGAAGCGATTGATACGAGCAAGGGAGGAGGGATGATA
 
. : . : . : . : . : . :
rJMSF012M06+ CCCGAAGACCAAGCTGGCGGCTGTTTCTGCTTTGCTCCAACTCGCGGTCCATAAGGCTTC
rJMFF039H22+ CCCGAAGACCAAGCTGGCGGCTGTTTCTGCTTTGCTCCAACTCGCGGTCCATAAGGCTTC
rJMFF029L02+ CCCGAAGACCAAGCTGGCGGCTGTTTCTGCTTTGCTCCAACTCGCGGTCCATAAGGCTTC
rJMFF033K17+ CCCGAAGACCAAGCTGGCGGCTGTTTCTGCTTTGCTCCAACTCGCGGTCCATAAGGCTTC
rJMFF041N19+ CCCGAAGACCAAGCTGGCGGCTGTTTCTGCTTTGCTCCAACTCGCGGTCCATAAGGCTTC
rJMFF011O13+ CCCGAAGACCAAGNTGGCGGCTGTTTGTGCTTTGNTCCAACTCGCGGTCCATAAGGCTTC
                      ____________________________________________________________
consensus CCCGAAGACCAAGCTGGCGGCTGTTTCTGCTTTGCTCCAACTCGCGGTCCATAAGGCTTC
 
. : . : . : . : . : . :
rJMSF012M06+ TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
rJMFF039H22+ TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
rJMFF029L02+ TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
rJMFF033K17+ TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
rJMFF041N19+ TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
rJMFF011O13+ TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
                      ____________________________________________________________
consensus TCCACACCCGCTCTCTTTTTGCCTTTCGTAAGGCGCTCGATTTGTACTCTCTGTACAAAC
 
. : . : . : . : . : . :
rJMSF012M06+ TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
rJMFF039H22+ TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
rJMFF029L02+ TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
rJMFF033K17+ TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
rJMFF041N19+ TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
rJMFF011O13+ TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
                      ____________________________________________________________
consensus TCATTTCCCTCTCAGACATCAAATAATTAGAGCAAAAAGTTCCAACTTCTCTTGTTCTTT
 
. : . : . : . : . : . :
rJMSF012M06+ GTCACAGTGTAANCCATGGTTTGTTAATTTTCGAGATTTTCTTGC
rJMFF039H22+ GTCACAGTGTAA-CCATGGTTTGTTAATTTTCGAGATTTTCTTGCACAGTTCTGTACTAT
rJMFF029L02+ GTCACAGTGTAA-CCATGGTTTGTTAATTTTCGAGATTTTCTTGCACAGTTCTGTACTAT
rJMFF033K17+ GTCACAGTGTAA-CCATGGTTTGTTAATTTTCGAGATTTTCTTGCACAGTTCTGTACTAT
rJMFF041N19+ GTCACAGTGTAA-CCATGGTTTGTTAATTTTCGAGATTTTCTTGCACAGTTCTGTACTAT
rJMFF011O13+ GTCACAGTGTAN-CCATGGTTTGTTAATTTTCGAGATTTTCTTGCACAGTTCTGTACTAT
                      ____________________________________________________________
consensus GTCACAGTGTAA-CCATGGTTTGTTAATTTTCGAGATTTTCTTGCACAGTTCTGTACTAT
 
. : . : . : . : . : . :
rJMFF039H22+ ACCAGGTGCTCGATTTGTCGTATAA
rJMFF029L02+ ACCAGGTGCTCGATTTGTCGTATAA
rJMFF033K17+ ACCAGGTGCTCGATTTGTCGTATAA
rJMFF041N19+ ACCAGGTGCTCGATTTGTCGTATAATGCATTTTGATTCTTC
rJMFF011O13+ ACCAGGTGCTCGATTTGTCGTATAATGCATTTTGATTCTTCACAATGTNNTCATAAAATC
                      ____________________________________________________________
consensus ACCAGGTGCTCGATTTGTCGTATAATGCATTTTGATTCTTCACAATGTNNTCATAAAATC