Previous Contig 008737:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011O12Sequence594007598 (3)gb:OST17804_16983744e-19Oryza sativa indica(GLA4) genomic DNA, chromosome 4, BAC clone:t17804.733008737 (3)gb:AC084329_12054393e-05Leishmania major strain Friedlin chromosome 35 clone L2289, complete sequence.
JMSF044D12Sequence713007598 (3)gb:OST17804_16983746e-19Oryza sativa indica(GLA4) genomic DNA, chromosome 4, BAC clone:t17804.734008737 (3)
JMSF044H20Sequence710007598 (3)gb:OST17804_16983746e-19Oryza sativa indica(GLA4) genomic DNA, chromosome 4, BAC clone:t17804.634008737 (3)pir|T29959|T299590.043DNA-directed RNA polymerase II large subunit ama-1 - Caenorhabditis elegans

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044D12+ GCGAGTGAAATTCGTGGAAGAACGGAGATTCCTG
rJMFF011O12+ AACGGAGATTCCTG
                      ____________________________________________________________
consensus GCGAGTGAAATTCGTGGAAGAACGGAGATTCCTG
 
. : . : . : . : . : . :
rJMSF044D12+ CCGGATGNCCCGGCACTTTTCAGATTGCCAACAGACTTACATCGGGATACAACTTCTATT
rJMFF011O12+ CCGGATG-CCCGGCACTTTTCAGATTGCCAACAGACTTACATCGGGATACAACTTCTATT
                      ____________________________________________________________
consensus CCGGATGNCCCGGCACTTTTCAGATTGCCAACAGACTTACATCGGGATACAACTTCTATT
 
. : . : . : . : . : . :
rJMSF044H20+ CTCTACAATTCAGTATGGTAAATCGNTCCCCTGAAACTGTTTCCGATATGTTCTTCCCC
rJMSF044D12+ CCTCTACAATTCAGTATGGTAAATCGTTCCCCTGAAACTGTTTCCGATATGTTCTTCCCC
rJMFF011O12+ CCTCTACAATTCAGTATGGTAAATCGTTCCCCTGAAACTGTTTCCGATATGTTCTTCCCC
                      ____________________________________________________________
consensus CCTCTACAATTCAGTATGGTAAATCGTTCCCCTGAAACTGTTTCCGATATGTTCTTCCCC
 
. : . : . : . : . : . :
rJMSF044H20+ AGCCATTTCCTCGAGTCTCGATCTACCTCTTCTGCAGGGAGTCCATTCTCTTCCATCCCC
rJMSF044D12+ AGCCATTTCCTCGAGTCTCGATCTACCTCTTCTGCAGGGAGTCCATTCTCTTCCATCCCC
rJMFF011O12+ AGCCATTTCCTCGAGTCTCGATCTACCTCTTCTGCAGGGAGTCCATTCTCTTCCATCCCC
                      ____________________________________________________________
consensus AGCCATTTCCTCGAGTCTCGATCTACCTCTTCTGCAGGGAGTCCATTCTCTTCCATCCCC
 
. : . : . : . : . : . :
rJMSF044H20+ ACCAACCCTTCTATACAAATTGGATCAAGAAATGCACCGTGGAGGCCAATGTTTGAGCCT
rJMSF044D12+ ACCAACCCTTCTATACAAATTGGATCAAGAAATGCACCGTGGAGGCCAATGTTTGAGCCT
rJMFF011O12+ ACCAACCCTTCTATACAAATTGGATCAAGAAATGCACCGTGGAGGCCAATGTTTGAGCCT
                      ____________________________________________________________
consensus ACCAACCCTTCTATACAAATTGGATCAAGAAATGCACCGTGGAGGCCAATGTTTGAGCCT
 
. : . : . : . : . : . :
rJMSF044H20+ TCCGTTAATACCAGTCTACCCTCTTCCTCAAGATCGAATCTTTTCGATCCTCAGTCAAGT
rJMSF044D12+ TCCGTTAATACCAGTCTACCCTCTTCCTCAAGATCGAATCTTTTCGATCCTCAGTCAAGT
rJMFF011O12+ TCCGTTAATACCAGTCTACCCTCTTCCTCAAGATCGAATCTTTTCGATCCTCAGTCAAGT
                      ____________________________________________________________
consensus TCCGTTAATACCAGTCTACCCTCTTCCTCAAGATCGAATCTTTTCGATCCTCAGTCAAGT
 
. : . : . : . : . : . :
rJMSF044H20+ GCAGCCAGTCCTTTTTCTAGTAACCATAGTTTCCCAACCTACCCTTTCTCCCCTGCCATG
rJMSF044D12+ GCAGCCAGTCCTTTTTCTAGTAACCATAGTTTCCCAACCTACCCTTTCTCCCCTGCCATG
rJMFF011O12+ GCAGCCAGTCCTTTTTNTAGTAACCATAGTTTCCCAACCTACCCTTTCTCCCCTGCCATG
                      ____________________________________________________________
consensus GCAGCCAGTCCTTTTTCTAGTAACCATAGTTTCCCAACCTACCCTTTCTCCCCTGCCATG
 
. : . : . : . : . : . :
rJMSF044H20+ ACCCCGCAATTATCTTCTCCCATCGGATTCTCATCCGCCCATTCTGCCCGGGAAAACAAC
rJMSF044D12+ ACCCCGCAATTATCTTCTCCCATCGGATTCTCATCCGCCCATTCTGCCCGGGAAAACAAC
rJMFF011O12+ ACCCCGCAATTATCTTCTCCCATCGGATTCTCATCCGCCCATTCTGCCCGGGAAAACAAC
                      ____________________________________________________________
consensus ACCCCGCAATTATCTTCTCCCATCGGATTCTCATCCGCCCATTCTGCCCGGGAAAACAAC
 
. : . : . : . : . : . :
rJMSF044H20+ ACACCACCTCCTGCAACACGCTTCTCGCTCTACGATGATCATGTAAGACCAAATATGCAC
rJMSF044D12+ ACACCACCTCCTGCAACACGCTTCTCGCTCTACGATGATCATGTAAGACCAAATATGCAC
rJMFF011O12+ ACACCACCTCCTGCAACACGCTTCTCGCTNTACGATGATCATGTAAGACCAAATATGCAC
                      ____________________________________________________________
consensus ACACCACCTCCTGCAACACGCTTCTCGCTCTACGATGATCATGTAAGACCAAATATGCAC
 
. : . : . : . : . : . :
rJMSF044H20+ AGGTAGTATCTTGCTACTGTTTTTATAGCCATGCAGTTTTAATGTCTGAATGAAGATATT
rJMSF044D12+ AGGTAGTATCTTGCTACTGTTTTTATAGCCATGCAGTTTTAATGTCTGAATGAAGATATT
rJMFF011O12+ AGGTAGTATCTTGCTACTGTTTTTATAGCCATGCAGTTTTAATGTCTGAATGAAGATATT
                      ____________________________________________________________
consensus AGGTAGTATCTTGCTACTGTTTTTATAGCCATGCAGTTTTAATGTCTGAATGAAGATATT
 
. : . : . : . : . : . :
rJMSF044H20+ TTTATTTGGGTTATATATTGTCATTTATTGCAACTGGGCACTTAGGTTTATAAATGTTTT
rJMSF044D12+ TTTATTTGGGTTATATATTGTCATTTATTGCAACTGGGCACTTAGGTTTATAAATGTTTT
rJMFF011O12+ TTTATTTGGGTTATATATTGTCATTTATTGCAACTGGGCACTTAGGTTTATAAATGTTTT
                      ____________________________________________________________
consensus TTTATTTGGGTTATATATTGTCATTTATTGCAACTGGGCACTTAGGTTTATAAATGTTTT
 
. : . : . : . : . : . :
rJMSF044H20+ ATAAGCAGCTGTTGTTGTATCTAAGATATATATTGGCTTGTAAACTTTTACAGTAGCTCA
rJMSF044D12+ ATAAGCAGCTGTTGTTGTATCTAAGATATATATTGGCTTGTAAACTTTTACAGTAGCTCA
rJMFF011O12+ ATAAGCAGCTGTTGTTGTATCTAAGATATATATTGGCTTGTAAACTTTTACAGTAGCTCA
                      ____________________________________________________________
consensus ATAAGCAGCTGTTGTTGTATCTAAGATATATATTGGCTTGTAAACTTTTACAGTAGCTCA
 
. : . : . : . : . : . :
rJMSF044H20+ TAGAAATGCGGTTTGTAAGAAGGTAATAAACAAC
rJMSF044D12+ TAGAAATGCGGTTTGTAAGAAGGTAATAAACAAC
rJMFF011O12+ TAGAAATGCGGTTTGTAAGAAGGTAATAAACAACATATATGTATTTTTCATGTTAATAAG
                      ____________________________________________________________
consensus TAGAAATGCGGTTTGTAAGAAGGTAATAAACAACATATATGTATTTTTCATGTTAATAAG