Previous Contig 008736:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011N18Sequence573008736 (4)sp|Q9ZNS1|RS7_AVIMR1e-7340S ribosomal protein S7.>gb:AF056316_1764696 Avicennia marina 40S ribosome prot773008736 (4)sp|Q9ZNS1|RS7_AVIMR7e-9140S ribosomal protein S7.>gb:AF056316_1764696 Avicennia marina 40S ribosome prot
JMFF023J13Sequence413008736 (4)sp|Q9ZNS1|RS7_AVIMR2e-4540S ribosomal protein S7.>gb:AF056316_1764696 Avicennia marina 40S ribosome prot701008736 (4)sp|Q9ZNS1|RS7_AVIMR4e-8040S ribosomal protein S7.>gb:AF056316_1764696 Avicennia marina 40S ribosome prot

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023J13- CTCCGCCATCTCCGAAGC
JMFF011N18- CTCCGCCATCTCCGAAGC
                      ____________________________________________________________
consensus CTCCGCCATCTCCGAAGC
 
. : . : . : . : . : . :
JMFF023J13- CGAAGGTAGGGTTCAGACTTGATAGCTCTCTCTCTCTCTACGTACAGGCCCGGTCGGCTA
JMFF011N18- CGAAGGTAGGGTTCAGACTTGATAGCTCTCTCTCTCTCTACGTACAGGCCCGGTCGGCTA
                      ____________________________________________________________
consensus CGAAGGTAGGGTTCAGACTTGATAGCTCTCTCTCTCTCTACGTACAGGCCCGGTCGGCTA
 
. : . : . : . : . : . :
JMFF023J13- TCTGTTTGCTAGAAGGTTTCAAAATGTACACTGCACTGCAGAAGATTCACAAGGATAAGG
JMFF011N18- TCTGTTTGCTAGAAGGTTTCAAAATGTACACTGCACTGCAGAAGATTCACAAGGATAAGG
rJMFF011N18+ GCTAGAAGGTTTCAAAATGTACACTGCACTGCAGAAGATTCACAAGGATAAGG
                      ____________________________________________________________
consensus TCTGTTTGCTAGAAGGTTTCAAAATGTACACTGCACTGCAGAAGATTCACAAGGATAAGG
 
. : . : . : . : . : . :
JMFF023J13- ATGTTGAACCATCTGAGTTTGAGGAGACTGTTGCCCAGGCATTTTTTGACTTGGAAAATA
JMFF011N18- ATGTTGAACCATCTGAGTTTGAGGAGACTGTTGCCCAGGCATTTTTTGACTTGGAAAATA
rJMFF023J13+ TTGAGGAGACTGTTGCCCAGGCATTTTTTGACTTGGAAAATA
rJMFF011N18+ ATGTTGAACCATCTGAGTTTGAGGAGACTGTTGCCCAGGCATTTTTTGACTTGGAAAATA
                      ____________________________________________________________
consensus ATGTTGAACCATCTGAGTTTGAGGAGACTGTTGCCCAGGCATTTTTTGACTTGGAAAATA
 
. : . : . : . : . : . :
JMFF023J13- CCAACCAAGAGCTTAAGAGTGATCTAAAGGACCTCTATATTAACTCTGCTGTTCAGATTG
JMFF011N18- CCAACCAAGAGCTTAAGAGTGATCTAAAGGACCTCTATATTAACTCTGCTGTTCAGATTG
rJMFF023J13+ CCAACCAAGAGCTTAAGAGTGATCTAAAGGACCTCTATATTAACTCTGCTGTTCAGATTG
rJMFF011N18+ CCAACCAAGAGCTTAAGAGTGATCTAAAGGACCTCTATATTAACTCTGCTGTTCAGATTG
                      ____________________________________________________________
consensus CCAACCAAGAGCTTAAGAGTGATCTAAAGGACCTCTATATTAACTCTGCTGTTCAGATTG
 
. : . : . : . : . : . :
JMFF023J13- ACATTTCTGGGAACCGCAAAGCTGTTGTGATCCATGTCCCTTACAGATTAAGGAAAGCTT
JMFF011N18- ACATTTCTGGGAACCGCAAAGCTGTTGTGATCCATGTCCCTTACAGATTAAGGAAAGCTT
rJMFF023J13+ ACATTTCTGGGAACCGCAAAGCTGTTGTGATCCATGTCCCTTACAGATTAAGGAAAGCTT
rJMFF011N18+ ACATTTCTGGGAACCGCAAAGCTGTTGTGATCCATGTCCCTTACAGATTAAGGAAAGCTT
                      ____________________________________________________________
consensus ACATTTCTGGGAACCGCAAAGCTGTTGTGATCCATGTCCCTTACAGATTAAGGAAAGCTT
 
. : . : . : . : . : . :
JMFF023J13- TCCGTAAGATTCACCTTAGGCTTGTCAGAGAGCTTGAGAAAAAGTTCAGTGGGAAGGATG
JMFF011N18- TCCGTAAGATTCACCTTAGGCTTGTCAGAGAGCTTGAGAAAAAGTTCAGTGGGAAGGATG
rJMFF023J13+ TCCGTAAGATTCACCTTAGGCTTGTCAGAGAGCTTGAGAAAAAGTTCAGTGGGAAGGATG
rJMFF011N18+ TCCGTAAGATTCACCTTAGGCTTGTCAGAGAGCTTGAGAAAAAGTTCAGTGGGAAGGATG
                      ____________________________________________________________
consensus TCCGTAAGATTCACCTTAGGCTTGTCAGAGAGCTTGAGAAAAAGTTCAGTGGGAAGGATG
 
. : . : . : . : . : . :
JMFF023J13- TTGTTCTTGTTGCTACGAGAAGGATAGCACGTCC
JMFF011N18- TTGTTCTTGTTGCTACGAGAAGGATAGCACGTCCACCAAAAAGGGGCTCTGCTGTACAGA
rJMFF023J13+ TTGTTCTTGTTGCTACGAGAAGGATAGCACGTCCACCAAAAAGGGGCTCTGCTGTACAGA
rJMFF011N18+ TTGTTCTTGTTGCTACGAGAAGGATAGCACGTCCACCAAAAAGGGGCTCTGCTGTACAGA
                      ____________________________________________________________
consensus TTGTTCTTGTTGCTACGAGAAGGATAGCACGTCCACCAAAAAGGGGCTCTGCTGTACAGA
 
. : . : . : . : . : . :
JMFF011N18- GACCTCGCTCTCGGACACTTACAGCTGTGCATGAGGCAATTCTTGAGGATCTAGTGTACC
rJMFF023J13+ GACCTCGCTCTCGGACACTTACAGCTGTGCATGAGGCAATTCTTGAGGATCTAGTGTACC
rJMFF011N18+ GACCTCGCTCTCGGACACTTACAGCTGTGCATGAGGCAATTCTTGAGGATCTAGTGTACC
                      ____________________________________________________________
consensus GACCTCGCTCTCGGACACTTACAGCTGTGCATGAGGCAATTCTTGAGGATCTAGTGTACC
 
. : . : . : . : . : . :
JMFF011N18- CTGCTGAGATTGTANGAAAGCGCATCAGATACCGTATTGATGGTTCAAAAATAATGAAGG
rJMFF023J13+ CTGCTGAGATTGTAGGAAAGCGCATCAGATACCGTATTGATGGTTCAAAAATAATGAAGG
rJMFF011N18+ CTGCTGAGATTGTAGGAAAGCGCATCAGATACCGTATTGATGGTTCAAAAATAATGAAGG
                      ____________________________________________________________
consensus CTGCTGAGATTGTAGGAAAGCGCATCAGATACCGTATTGATGGTTCAAAAATAATGAAGG
 
. : . : . : . : . : . :
JMFF011N18- TTTTCTTGGATCCAA
rJMFF023J13+ TTTTCTTGGATCCAAAGTTCAGGAATGACACTGAATACAAATTAGAGACATATGCTGGTG
rJMFF011N18+ TTTTCTTGGATCCAAAGTTCAGGAATGACACTGAATACAAATTAGAGACATATGCTGGTG
                      ____________________________________________________________
consensus TTTTCTTGGATCCAAAGTTCAGGAATGACACTGAATACAAATTAGAGACATATGCTGGTG
 
. : . : . : . : . : . :
rJMFF023J13+ TCTACAGGAAGCTTTCAGGGAAAGATGTTGTCTTTGAATATCCAATAACTGAAGCTTAAG
rJMFF011N18+ TCTACAGGAAGCTTTCAGGGAAAGATGTTGTCTTTGAATATCCAATAACTGAAGCTTAAG
                      ____________________________________________________________
consensus TCTACAGGAAGCTTTCAGGGAAAGATGTTGTCTTTGAATATCCAATAACTGAAGCTTAAG
 
. : . : . : . : . : . :
rJMFF023J13+ AGGGCCTTTCTTTTCCTGTTTGATACGTGTCTTAAGTTGAAGCATGTCTGCTTTTATTGT
rJMFF011N18+ AGGGCCTTTCTTTTCCTGTTTGATACGTGTCTTAAGTTGAAGCATGTCTGCTTTTATTGT
                      ____________________________________________________________
consensus AGGGCCTTTCTTTTCCTGTTTGATACGTGTCTTAAGTTGAAGCATGTCTGCTTTTATTGT
 
. : . : . : . : . : . :
rJMFF023J13+ CTAGGCTTTCTGAAATTTTTTTGATTGGCAAACATTTCCTTCAGAAGTGAGAATATTTAT
rJMFF011N18+ CTAGGCTTTCTGAAATTTTTTTGATTGGCAAACATTTCCTTCAGAAGTGAGAATATTTAT
                      ____________________________________________________________
consensus CTAGGCTTTCTGAAATTTTTTTGATTGGCAAACATTTCCTTCAGAAGTGAGAATATTTAT
 
. : . : . : . : . : . :
rJMFF023J13+ GAAAGATTGTTTGTGATTAGTCTTGGAAAAAGTTTGGTTGAACTTTCATACNGAAACAA
rJMFF011N18+ GAAAGATTGTTTGTGATTAGTCTTGGAAAAAGTTTGGTTGAACTTTCATACNGAAACAAA
                      ____________________________________________________________
consensus GAAAGATTGTTTGTGATTAGTCTTGGAAAAAGTTTGGTTGAACTTTCATACNGAAACAAA