Previous Contig 008731:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M07Sequence510006761 (10)pir|A84857|A848571e-50probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi639008731 (8)pir|A84857|A848576e-44probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMFF014H17Sequence583006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi709008731 (8)pir|A84857|A848579e-50probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF020B17Sequence596006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi762008731 (8)pir|A84857|A848574e-59probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF021D11Sequence596006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi777008731 (8)pir|A84857|A848572e-63probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF030A20Sequence663006761 (10)pir|A84857|A848576e-61probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi696008731 (8)pir|A84857|A848571e-53probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF031M12Sequence646006761 (10)pir|A84857|A848571e-57probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi762008731 (8)pir|A84857|A848572e-60probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF044C04Sequence596006761 (10)pir|A84857|A848575e-58probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi709008731 (8)pir|A84857|A848577e-55probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF048J19Sequence660006761 (10)pir|A84857|A848572e-60probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi776008731 (8)pir|A84857|A848572e-63probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048J19+ CGGGGCATAGCCTCGGAGCAAGT
rJMSF031M12+ CGGAGCAAGT
rJMSF021D11+ CACGGGGCATAGCCTCGGAGCAAGT
rJMSF020B17+ CGGAGCAAG-
                      ____________________________________________________________
consensus CACGGGGCATAGCCTCGGAGCAAGT
 
. : . : . : . : . : . :
rJMSF048J19+ TTAGCAATCCTAGCAGCTTTCGATCTATGCGAAAACGGCGTCACCGACATTCCGGTGACG
rJMSF031M12+ TTAGCCATCCTAGCAGCTTTCGATCTATGCGAAAACGGCGTCACCGACATTCCGGTGACG
rJMSF044C04+ CACCGACATTCCGGTGACG
rJMSF030A20+ GGTGACG
rJMSF021D11+ TTAGCAATCCTAGCAGCTTTCGATCTATGCGAAAACGGCGTCACCGACATTCCGGTGACG
rJMSF020B17+ TTAGCAATCCTAGCAGCTTTCGATCTATGCGAAAACGGCGTCACCGACATTCCGGTGACG
                      ____________________________________________________________
consensus TTAGCAATCCTAGCAGCTTTCGATCTATGCGAAAACGGCGTCACCGACATTCCGGTGACG
 
. : . : . : . : . : . :
rJMSF048J19+ GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
rJMSF031M12+ GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
rJMSF044C04+ GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAANCTGTTTGATAAACTGATGACTGAA
rJMSF030A20+ GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
rJMSF021D11+ GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
rJMSF020B17+ GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
rJMFF014H17+ TCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
                      ____________________________________________________________
consensus GCCATCGTCTTCGGCAGCCCTCAAATCGGCAACAAACTGTTTGATAAACTGATGACTGAA
 
. : . : . : . : . : . :
rJMSF048J19+ AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMSF031M12+ AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMSF044C04+ AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMSF030A20+ AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMSF021D11+ AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMSF020B17+ AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMFF014H17+ AAGACAAACCTTAAAAACCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
rJMFF011M07+ CACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
                      ____________________________________________________________
consensus AAGACAAACCTTAAAATCCTACACATCCGCAACAAGATCGATATGATCCCGGAGTACCCA
 
. : . : . : . : . : . :
rJMSF048J19+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMSF031M12+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMSF044C04+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMSF030A20+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMSF021D11+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMSF020B17+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMFF014H17+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
rJMFF011M07+ GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
                      ____________________________________________________________
consensus GGAGCCCTGTTGGGATACGTGAAGTCAGGGCTGGAATTCGTGATCGACCACCGGAAGTCG
 
. : . : . : . : . : . :
rJMSF048J19+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMSF031M12+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMSF044C04+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMSF030A20+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMSF021D11+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMSF020B17+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMFF014H17+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
rJMFF011M07+ ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
                      ____________________________________________________________
consensus ACGAGCCTGAAGAACTCGATGAACCCTAGCGACTGGCATAACTTGCAGGCGATGTTGCAC
 
. : . : . : . : . : . :
rJMSF048J19+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMSF031M12+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMSF044C04+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMSF030A20+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMSF021D11+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMSF020B17+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMFF014H17+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
rJMFF011M07+ GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
                      ____________________________________________________________
consensus GTGGTGGCTGGGTGGAATGGGGAAGATGGGGAGTTTGAGTTGAAGGTGAAGAGGTGTGTG
 
. : . : . : . : . : . :
rJMSF048J19+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMSF031M12+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMSF044C04+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMSF030A20+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMSF021D11+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMSF020B17+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMFF014H17+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
rJMFF011M07+ GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
                      ____________________________________________________________
consensus GCCCTTGTGAACAAGTCTTGTGAGTTCTTGAAGGAAGAGCTTTTCATTCCGGGGTCATGG
 
. : . : . : . : . : . :
rJMSF048J19+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMSF031M12+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMSF044C04+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMSF030A20+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMSF021D11+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMSF020B17+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMFF014H17+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
rJMFF011M07+ TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
                      ____________________________________________________________
consensus TGGATTGAGAAGAATAAAAGTATGGTTCTTGATGAGAATGGAGAGTGGGTTTTGGGATCA
 
. : . : . : . : . : . :
rJMSF048J19+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
rJMSF031M12+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
rJMSF044C04+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
rJMSF030A20+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
rJMSF021D11+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
rJMSF020B17+ CCTAATGACGAGGACCTACCCGTCCCTGAACACTAAGGCCAGACAATCTTAACAGGTTAA
rJMFF014H17+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
rJMFF011M07+ CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
                      ____________________________________________________________
consensus CCTAATGACGAGGACCTACCCGTCCCTGAATACTAAGGCCAGACAATCTTAACAGGTTAA
 
. : . : . : . : . : . :
rJMSF048J19+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMSF031M12+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMSF044C04+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMSF030A20+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMSF021D11+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMSF020B17+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMFF014H17+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
rJMFF011M07+ GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
                      ____________________________________________________________
consensus GGATCAGTCTCGAAGACAGTTCGGCCAAGCAACCTTAACGGGTTAAGGATCAGTCTCGAA
 
. : . : . : . : . : . :
rJMSF048J19+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
rJMSF031M12+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
rJMSF044C04+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGCCTGACTTTTTTACGT
rJMSF030A20+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
rJMSF021D11+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
rJMSF020B17+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
rJMFF014H17+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
rJMFF011M07+ GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
                      ____________________________________________________________
consensus GACAGTTCTTATAACTAAGAATCTTGTAATTATTAAGTTAATTGTCTGACTTTTTTACGT
 
. : . : . : . : . : . :
rJMSF048J19+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMSF031M12+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMSF044C04+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMSF030A20+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMSF021D11+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMSF020B17+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMFF014H17+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
rJMFF011M07+ TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
                      ____________________________________________________________
consensus TGTCTCTTCATTTATACTTTTAATGTGTGTTCTTTGAGTGTTGTTCTTGAAGTTTGTGTA
 
. : . : . : . : . : . :
rJMSF048J19+ TTTATTTGCTGTCTTTTGTATTATAATGGGTG
rJMSF031M12+ TTTATTTGCTGTCTTTTGTATTATAATGGGTG
rJMSF044C04+ TTTATTTGCTGTCTTTTGTATTATAATGGG
rJMSF030A20+ TTTATTTGCTGTCTTTTGTATTATAATGG
rJMSF021D11+ TTTATTTGCTGTCTTTTGTATTATAATGGGTG
rJMSF020B17+ TTTATTTGCTGTCTTTTGTATTATAATGGGTG
rJMFF014H17+ TTTATTTGCTGTCTTTTGTATTATAATGGGTGTGTAATTGTTGTGTCTCAAAAAAAA
rJMFF011M07+ TTTATTTGCTGTCTTTTGTATTATAATGGGTGTGTAATTGTTGTGTCTCAATAAAAAATT
                      ____________________________________________________________
consensus TTTATTTGCTGTCTTTTGTATTATAATGGGTGTGTAATTGTTGTGTCTCAATAAAAAATT