Previous Contig 008727:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011L05Sequence548004295 (7)gb:AB051818_15211505e-19Nierembergia caerulea mRNA for Na H-antiportor, complete cds.667008727 (6)gb:AB051818_15211503e-33Nierembergia caerulea mRNA for Na H-antiportor, complete cds.
JMFF015P23Sequence500004295 (7)gb:AB051818_15211502e-10Nierembergia caerulea mRNA for Na H-antiportor, complete cds.611008727 (6)gb:AB051818_15211502e-25Nierembergia caerulea mRNA for Na H-antiportor, complete cds.
JMFN009D20Sequence640008727 (6)gb:AB051818_15211507e-42Nierembergia caerulea mRNA for Na H-antiportor, complete cds.
JMSF001D04Sequence315004295 (7)760008727 (6)gb:AB051818_15211504e-52Nierembergia caerulea mRNA for Na H-antiportor, complete cds.
JMSF026H12Sequence653004295 (7)gb:AB051818_15211503e-36Nierembergia caerulea mRNA for Na H-antiportor, complete cds.761008727 (6)gb:AB051818_15211502e-70Nierembergia caerulea mRNA for Na H-antiportor, complete cds.
JMSF036F23Sequence672004295 (7)gb:AB051818_15211502e-40Nierembergia caerulea mRNA for Na H-antiportor, complete cds.692008727 (6)gb:AB051818_15211501e-37Nierembergia caerulea mRNA for Na H-antiportor, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026H12+ CCGG
                      ____________________________________________________________
consensus CCGG
 
. : . : . : . : . : . :
rJMSF026H12+ GGTGAAAAGATTGGATTTAGGCAGCAGTTTATAATATGGTGGGCTGGGCTTATGCGAGGT
                      ____________________________________________________________
consensus GGTGAAAAGATTGGATTTAGGCAGCAGTTTATAATATGGTGGGCTGGGCTTATGCGAGGT
 
. : . : . : . : . : . :
rJMSF026H12+ GCTGTTTCAATGGCTCTTGCATATAACCAGTTTACAAGGTCTGGCTACACCCAGTTACGT
rJMSF001D04+ CCCAGTTACGT
                      ____________________________________________________________
consensus GCTGTTTCAATGGCTCTTGCATATAACCAGTTTACAAGGTCTGGCTACACCCAGTTACGT
 
. : . : . : . : . : . :
rJMSF026H12+ GAGAATGCAATAATGATCACGAGCACAATTACAGTTGTTCTTTTCAGCACTGTGGTTTTT
JMFN009D20- GGTTTTT
rJMSF001D04+ GAGAATGCAATAATGATCACGAGCACAATTACAGTTGTTCTTTTCAGCACTGTGGTTTTT
                      ____________________________________________________________
consensus GAGAATGCAATAATGATCACGAGCACAATTACAGTTGTTCTTTTCAGCACTGTGGTTTTT
 
. : . : . : . : . : . :
rJMSF026H12+ GGTTTGATAACCAAACCTTTGATCAGGGTCTTGCTGCCCACACCAAAACACCTAAACAGA
JMFN009D20- GGTTTGATAACCAAACCTTTGATCAGGGTCTTGCTGCCCACACCAAAACACCTAAACAGA
rJMSF001D04+ GGTTTGATAACCAAACCTTTGATCAGGGTCTTGCTGCCCACACCAAAACACCTAAACAGA
rJMSF036F23+ GTTTGATAACC-AACCTTTGATCAGGGTCTTGCTGCCCACACCAAANCACCTAAACAGA
rJMFF011L05+ TAAACAGA
                      ____________________________________________________________
consensus GGTTTGATAACCAAACCTTTGATCAGGGTCTTGCTGCCCACACCAAAACACCTAAACAGA
 
. : . : . : . : . : . :
rJMSF026H12+ ATGGTGTCTTCTGAACCAGTCACTCCAAAATCCTTCACTGTGCCTCTTCTGGATTCAGAG
JMFN009D20- ATGGTGTCTTCTGAACCAGTCACTCCAAAATCCTTCACTGTGCCTCTTCTGGATTCAGAG
rJMSF001D04+ ATGGTGTCTTCTGAACCAGTCACTCCAAAATCCTTCACTGTGCCTCTTCTGGATTCAGAG
rJMSF036F23+ ATGGTGTCTTCTGAACCAGTCACTCCAAAATCCTTCACTGTGCCTCTTCTGGATTCAGAG
rJMFF015P23+ TGGATTCAGAG
rJMFF011L05+ ATGGTGTCTTCTGAACCAGTCACTCCAAAATCCTTCACTGTGCCTCTTCTGGATTCAGAG
                      ____________________________________________________________
consensus ATGGTGTCTTCTGAACCAGTCACTCCAAAATCCTTCACTGTGCCTCTTCTGGATTCAGAG
 
. : . : . : . : . : . :
rJMSF026H12+ GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
JMFN009D20- GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
rJMSF001D04+ GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
rJMSF036F23+ GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
rJMFF015P23+ GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
rJMFF011L05+ GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
                      ____________________________________________________________
consensus GCCGACCTAGATGGCCATGTGCCACGTCCAAACAGCTTGCGCATGCTGCTGACAACACCA
 
. : . : . : . : . : . :
rJMSF026H12+ TCTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
JMFN009D20- TCTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
rJMSF001D04+ TCTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
rJMSF036F23+ TCTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
rJMFF015P23+ TNTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
rJMFF011L05+ TCTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
                      ____________________________________________________________
consensus TCTCACACGGCCCACTACTATTGGAGAAAATTCGACGATGCATTCATGCGACCTGTCTTT
 
. : . : . : . : . : . :
rJMSF026H12+ GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
JMFN009D20- GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
rJMSF001D04+ GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
rJMSF036F23+ GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
rJMFF015P23+ GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
rJMFF011L05+ GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
                      ____________________________________________________________
consensus GGTGGACGAGGCTTTGTACCATATGTCCCTGGCTCACCTACTGAACAGAATGAACCACAA
 
. : . : . : . : . : . :
rJMSF026H12+ TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
JMFN009D20- TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
rJMSF001D04+ TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
rJMSF036F23+ TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
rJMFF015P23+ TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
rJMFF011L05+ TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
                      ____________________________________________________________
consensus TGGCAGTGAAAGAGAAGCACTGTACTACACTATATGCCCCGTGAACAGAATGAACAACAA
 
. : . : . : . : . : . :
rJMSF026H12+ TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGG-AAAAAAGTTT
JMFN009D20- TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGG-AAAAAAGTTT
rJMSF001D04+ TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGGAAAAAAAGTTT
rJMSF036F23+ TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGG-AAAAAAGTTT
rJMFF015P23+ TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGG-AAAAAAGTTT
rJMFF011L05+ TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGG-AAAAAAGTTT
                      ____________________________________________________________
consensus TGGGCGCACTGAAAGAGTGCACTATCTGCCCGCCCATCCTCGACATGGG-AAAAAAGTTT
 
. : . : . : . : . : . :
rJMSF026H12+ TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTTGTATGTCTGAGTAAA
JMFN009D20- TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTTGTATGTCTGAGTAAA
rJMSF001D04+ TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTTGTATGTCTGAGTAAA
rJMSF036F23+ TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTTGTATGTCTGAGTAAA
rJMFF015P23+ TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTT-TATGTCTGAGTAAA
rJMFF011L05+ TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTTGTATGTCTGAGTAAA
                      ____________________________________________________________
consensus TACTTTGGTTGCATTTTGTAGTTTTGTTTCCTGTTAATATTTTTTGTATGTCTGAGTAAA
 
. : . : . : . : . : . :
rJMSF026H12+ TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
JMFN009D20- TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
rJMSF001D04+ TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
rJMSF036F23+ TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
rJMFF015P23+ TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
rJMFF011L05+ TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
                      ____________________________________________________________
consensus TCAGCAATGATAGCATTAGGGTGTCGACTTTATAGATTGGCAAGTAGAAGTGTGCTTATT
 
. : . : . : . : . : . :
rJMSF026H12+ TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGT
JMFN009D20- TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGTGGGCAACACTGAGCCATTCATC
rJMSF001D04+ TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGTGGGCAACACTGAGCCATTCATC
rJMSF036F23+ TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGTGGGCAACACTGAGCCATTCATC
rJMFF015P23+ TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGTGGGCAACACTGAGCCATTCATC
rJMFF011L05+ TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGTGGGCAACACTGAGCCATTCATC
                      ____________________________________________________________
consensus TTTGGTATGATTTCACTTTTCAGTTAGTTCTTTACTGTGGGCAACACTGAGCCATTCATC
 
. : . : . : . : . : . :
JMFN009D20- AGTATATGGCATTTGCTAAATTCCCA
rJMSF001D04+ AGTATATGGCATTTGCTAAATTCCCAATTCAGAGGCCTTTCTATAAACCACCAAATGGGT
rJMSF036F23+ AGTATATGGCATTTGCTAAATTCCCAATTCAGAGGCCTTTCTATAAACCACCAAATGGGT
rJMFF015P23+ AGTATATGGCATTTGCTAAATTCCCAATTCAGAGGCCTTTCTATAAACCACCAAATGGGT
rJMFF011L05+ AGTATATGGCATTTGCTAAATTCCCAATTCAGAGGCCTTTCTATAAACCACCAAATGGGT
                      ____________________________________________________________
consensus AGTATATGGCATTTGCTAAATTCCCAATTCAGAGGCCTTTCTATAAACCACCAAATGGGT
 
. : . : . : . : . : . :
rJMSF001D04+ GTGTAATTTGTATGTAAACGTCTCCATGT
rJMSF036F23+ GTGTAATTTGTATGTAAACGTCTCCATGT
rJMFF015P23+ GTGTAATTTGTATGTAAACGTCTCCATGTTGTATTTAAACATTTCTGAATTTTTATTTAT
rJMFF011L05+ GTGTAATTTGTATGTAAACGTCTCCATGTTGTATTTAAACATTTCTGAATTTTTATTTAT
                      ____________________________________________________________
consensus GTGTAATTTGTATGTAAACGTCTCCATGTTGTATTTAAACATTTCTGAATTTTTATTTAT