Previous Contig 008724:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011K06Sequence575003216 (2)755008724 (2)gb:AE016959_10238652e-18Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMSF033F05Sequence605008724 (2)gb:AE016959_10238652e-11Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011K06+ GGGACGAAGGCAAGGTTTTGGCACATATACTTTCA
                      ____________________________________________________________
consensus GGGACGAAGGCAAGGTTTTGGCACATATACTTTCA
 
. : . : . : . : . : . :
rJMSF033F05+ GGGGAAAGTCAGTCTGGTCACTGGCAAAACGGGATTCTTAATGTTTCGAGTGCTC
rJMFF011K06+ GAAACGGGGAAAGTCAGTCTGGTCACTGGCAAAACGGGATTCTTAATGTTTCGAGTGCTC
                      ____________________________________________________________
consensus GAAACGGGGAAAGTCAGTCTGGTCACTGGCAAAACGGGATTCTTAATGTTTCGAGTGCTC
 
. : . : . : . : . : . :
rJMSF033F05+ CTGGGACCCGTACTGGATCTTCTGCGACAGATGATCATTCCAAAGTGTTGAATGCCGTTC
rJMFF011K06+ CTGGGACCCGTACTGGATCTTCTGCGACAGATGATCATTCCAAAGTGTTGAATGCCGTTC
                      ____________________________________________________________
consensus CTGGGACCCGTACTGGATCTTCTGCGACAGATGATCATTCCAAAGTGTTGAATGCCGTTC
 
. : . : . : . : . : . :
rJMSF033F05+ AGGAAGCGATTCGAGCTGCTGAGAAAGCTAACGACGTGGTTAAGGTAGACGAGCGGGTAA
rJMFF011K06+ AGGAAGCGATTCGAGCTGCTGAGAAAGCTAACGACGTGGTTAAGGTAGACGAGCGGGTAA
                      ____________________________________________________________
consensus AGGAAGCGATTCGAGCTGCTGAGAAAGCTAACGACGTGGTTAAGGTAGACGAGCGGGTAA
 
. : . : . : . : . : . :
rJMSF033F05+ AAAGGGCGGTGGCGACCGCTAATAAAGCGGCAACAGCGGCCAGAGTAACAGCTGTGAAGG
rJMFF011K06+ AAAGGGCGGTGGCGACCGCTAATAAAGCGGCAACAGCGGCCAGAGTAACAGCTGTGAAGG
                      ____________________________________________________________
consensus AAAGGGCGGTGGCGACCGCTAATAAAGCGGCAACAGCGGCCAGAGTAACAGCTGTGAAGG
 
. : . : . : . : . : . :
rJMSF033F05+ CAGTCCAAAACCAGATGCATCACGACAATAACCATTTCAACGTGCCAGTACCCATCGTCT
rJMFF011K06+ CAGTCCAAAACCAGATGCATCACGACAATAACCATTTCAACGTGCCAGTACCCATCGTCT
                      ____________________________________________________________
consensus CAGTCCAAAACCAGATGCATCACGACAATAACCATTTCAACGTGCCAGTACCCATCGTCT
 
. : . : . : . : . : . :
rJMSF033F05+ GAACCTACAAAGCTGGCTGAACGAGTGAACGACACAACGTTTTTCACATAATTTCCTTTG
rJMFF011K06+ GAACCTACAAAGCTGGCTGAACGAGTGAACGACACAACGTTTTTCACATAATTTCCTTTG
                      ____________________________________________________________
consensus GAACCTACAAAGCTGGCTGAACGAGTGAACGACACAACGTTTTTCACATAATTTCCTTTG
 
. : . : . : . : . : . :
rJMSF033F05+ ATCGTCATTTCTGAGGTAATTTCTTGGTTCTACCTATTAGAAAGTGAATACGAGGTATCT
rJMFF011K06+ ATCGTCATTTCTGAGGTAATTTCTTGGTTCTACCTATTAGAAAGTGAATACGAGGTATCT
                      ____________________________________________________________
consensus ATCGTCATTTCTGAGGTAATTTCTTGGTTCTACCTATTAGAAAGTGAATACGAGGTATCT
 
. : . : . : . : . : . :
rJMSF033F05+ GCTTGGAACCACATCAAGCATTTGCTGATCGAGGAGCAAGCTTAGATTCCTCTTCCCATT
rJMFF011K06+ GCTTGGAACCACATCAAGCATTTGCTGATCGAGGAGCAAGCTTAGATTCCTCTTCCCATT
                      ____________________________________________________________
consensus GCTTGGAACCACATCAAGCATTTGCTGATCGAGGAGCAAGCTTAGATTCCTCTTCCCATT
 
. : . : . : . : . : . :
rJMSF033F05+ TACGGGGCACTACTAAAATATATGTATATACCGTGGCTCGGGCTCTTTGAGCAGAGAAAA
rJMFF011K06+ TACGGGGCACTACTAAAATATATGTATATACCGTGGCTCGGGCTCTTTGAGCAGAGAAAA
                      ____________________________________________________________
consensus TACGGGGCACTACTAAAATATATGTATATACCGTGGCTCGGGCTCTTTGAGCAGAGAAAA
 
. : . : . : . : . : . :
rJMSF033F05+ AGCACTCAAGTGCTTGAGCTTTAGCGTAGGACTTCGAGCTGTTGAGCAACAACAGCTGAA
rJMFF011K06+ AGCACTCAAGTGCTTGAGCTTTAGCGTAGGACTTCGAGCTGTTGAGCAACAACAGCTGAA
                      ____________________________________________________________
consensus AGCACTCAAGTGCTTGAGCTTTAGCGTAGGACTTCGAGCTGTTGAGCAACAACAGCTGAA
 
. : . : . : . : . : . :
rJMSF033F05+ GAAGATGTA
rJMFF011K06+ GAAGATGTAAGTAATTTAGTGTATTTTCATGTTTTTGCCATAGGGAAATGGCAAAGTTTA
                      ____________________________________________________________
consensus GAAGATGTAAGTAATTTAGTGTATTTTCATGTTTTTGCCATAGGGAAATGGCAAAGTTTA
 
. : . : . : . : . : . :
rJMFF011K06+ GGGTTTCAATAGTATGTATAACATAGGGAAGGTTTGTATATTATTAACTTGTATGGCTTG
                      ____________________________________________________________
consensus GGGTTTCAATAGTATGTATAACATAGGGAAGGTTTGTATATTATTAACTTGTATGGCTTG