Previous Contig 008723:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G05Sequence506004963 (12)589008723 (4)gb:OSJN00171_16961420.021Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0061G20, complete seque
JMFF011K05Sequence570008723 (4)sp|P04929|HRPX_PLALO2e-07Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro700008723 (4)sp|P04929|HRPX_PLALO0.002Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro
JMSF009A12Sequence222018602gb:ATH303457_15524397e-07Arabidopsis thaliana partial mRNA for ribonucleoprotein 1 (rnp1 gene).727008723 (4)sp|P04929|HRPX_PLALO2e-05Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011K05- GAAATCCTAATGCTCC
                      ____________________________________________________________
consensus GAAATCCTAATGCTCC
 
. : . : . : . : . : . :
JMFF011K05- CAATAGTGGTGGCTATGGAAGTGGCCCAAGAAGCTCGTGGAGCTCTCAGAGTCCCTCTGG
rJMSF009A12+ TCGTGGAGCTCTCAGAGTCCCTCTGG
                      ____________________________________________________________
consensus CAATAGTGGTGGCTATGGAAGTGGCCCAAGAAGCTCGTGGAGCTCTCAGAGTCCCTCTGG
 
. : . : . : . : . : . :
JMFF011K05- GTATGGGAATGTCGGCTATGGAAGTGCCCCCTGGGGTAATTCCAATGCCGCTTCTGGTGG
rJMSF009A12+ GTATGGGAATGTCGGCTATGGAAGTGCCCCCTGGGGTAATTCCAATGCCGCTTCTGGTGG
                      ____________________________________________________________
consensus GTATGGGAATGTCGGCTATGGAAGTGCCCCCTGGGGTAATTCCAATGCCGCTTCTGGTGG
 
. : . : . : . : . : . :
JMFF011K05- CGGAGCTGCTGCGGGGGGTCAATCACTGACGGGAGTGGCGGGATATGGCAACCAAGGCTA
rJMSF009A12+ CGGAGCTGCTGCGGGGGGTCAATCACTGACGGGAGTGGCGGGATATGGCAACCAAGGCTA
rJMFF011K05+ TCAATCACTGACGGGAGTGGCGGGATATGGCAACCAAGGCTA
                      ____________________________________________________________
consensus CGGAGCTGCTGCGGGGGGTCAATCACTGACGGGAGTGGCGGGATATGGCAACCAAGGCTA
 
. : . : . : . : . : . :
JMFF011K05- TGGTTATAGTGGGTTTGGTGGAAATGACGGGGCTTATGGAAATTCGTCTGCTTATGGGTC
rJMSF009A12+ TGGTTATAGTGGGTTTGGTGGAAATGACGGGGCTTATGGAAATTCGTCTGCTTATGGGTC
rJMFF011G05+ TTATGGGTC
rJMFF011K05+ TGGTTATAGTGGGTTTGGTGGAAATGACGGGGCTTATGGAAATTCGTCTGCTTATGGGTC
                      ____________________________________________________________
consensus TGGTTATAGTGGGTTTGGTGGAAATGACGGGGCTTATGGAAATTCGTCTGCTTATGGGTC
 
. : . : . : . : . : . :
JMFF011K05- TATCGGACGTGTTGGTGGTGCTCCAATAACAAGTTCACCGATTGGCGGTGGTGGTGCTAC
rJMSF009A12+ TATCGGACGTGTTGGTGGTGCTCCAAGAACAAGTTCACCGATTGGCGGTGGTGGTGCTAC
rJMFF011G05+ TATCGGACGTGTTGGTGGTGCTCCAATACCAAGTTCACCGATTGGCGGTGGTGGTGCTAC
rJMFF011K05+ TATCGGACGTGTTGGTGGTGCTCCAATAACAAGTTCACCGATTGGCGGTGGTGGTGCTAC
                      ____________________________________________________________
consensus TATCGGACGTGTTGGTGGTGCTCCAATAACAAGTTCACCGATTGGCGGTGGTGGTGCTAC
 
. : . : . : . : . : . :
JMFF011K05- AGGAGAGTTACAATATGGCAATGCGGGTGGAAATTCTGGATATGGAAGTGCAGGCTGGAG
rJMSF009A12+ AGGAGAGTTACAATATGGCAATGCGGGTGGAAATTCTGGATATGGAAGTGCAGGCTGGAG
rJMFF011G05+ AGGAGAGTTACAATATGGCAATGCGGGTGGAAATTCTGGATATGGAAGTGCAGGCTGGAG
rJMFF011K05+ AGGAGAGTTACAATATGGCAATGCGGGTGGAAATTCTGGATATGGAAGTGCAGGCTGGAG
                      ____________________________________________________________
consensus AGGAGAGTTACAATATGGCAATGCGGGTGGAAATTCTGGATATGGAAGTGCAGGCTGGAG
 
. : . : . : . : . : . :
JMFF011K05- ACCCGATATACCACAAGCTTCTGGCAATTATGGCT-CGAATGGATCCCATGGCGGCCAGG
rJMSF009A12+ ACCCGATATACCACAAGCTTCTGGCAATTATGGCT-CGAATGGATCCCATGGCGGCCAGG
rJMFF011G05+ ACCCGATATACCACAAGCTTCTGGCAATTATGGCTCCGAATGGATCCCATGGCGGCCAGG
rJMFF011K05+ ACCCGATATACCACAAGCTTCTGGCAATTATGGCT-CGAATGGATCCCATGGCGGCCAGG
                      ____________________________________________________________
consensus ACCCGATATACCACAAGCTTCTGGCAATTATGGCT-CGAATGGATCCCATGGCGGCCAGG
 
. : . : . : . : . : . :
JMFF011K05- TTGGGTATGGAAGCGGCTATAGTGGTATCCCAGGGCGGCAATCTCAACAGCAGTAATCGC
rJMSF009A12+ TTGGGTATGGAAGCGGCTATAGTGGTATCCCAGGGCGGCAATCTCAACAGCAGTAATCGC
rJMFF011G05+ TTGGGTATGGAAGCGGCTATAGTGGTATCCCAGGGCGGCAATCTCAACAGCAGTAATCGC
rJMFF011K05+ TTGGGTATGGAAGCGGCTATAGTGGTATCCCAGGGCGGCAATCTCAATAGCAGTAATCGC
                      ____________________________________________________________
consensus TTGGGTATGGAAGCGGCTATAGTGGTATCCCAGGGCGGCAATCTCAACAGCAGTAATCGC
 
. : . : . : . : . : . :
JMFF011K05- AATGTGCGACTCATTCTCGTCTTTGGAGTCTCTTCCCAGTTCCCGCCACTGATTTTGCAG
rJMSF009A12+ AATGTGCGACTCATTCTCGTCTTTGGAGTCTCTTCCCAGTTCCCGCCACTGATTTTGCAG
rJMFF011G05+ AATGTGCGACTCATTCTCGTCTTCGGAGTCTCTTCCCAGTTCCCGCCACTGATTTTGCAG
rJMFF011K05+ AATGTGCGACTCATTCTCGTCTTTGGAGTCTCTTCCCAGTTCCCGCCACTGATTTTGCAG
                      ____________________________________________________________
consensus AATGTGCGACTCATTCTCGTCTTTGGAGTCTCTTCCCAGTTCCCGCCACTGATTTTGCAG
 
. : . : . : . : . : . :
JMFF011K05- TTTCACGTGCTGGGA
rJMSF009A12+ TTTCACGTGCTGGGAGGATGAGGTTTTCAACGCATC-ATATATACCTGCTAAACGGGACT
rJMFF011G05+ TTTCACGTGCTGGGAGGATGAGGTTTTCAACGCATC-ATATATACCTGCTAAACGGGACT
rJMFF011K05+ TTTCACGTGCTGGGAGGATGAGGTTTTCAACGCATCGNTATATACCTGCTAAACGGGACT
                      ____________________________________________________________
consensus TTTCACGTGCTGGGAGGATGAGGTTTTCAACGCATC-ATATATACCTGCTAAACGGGACT
 
. : . : . : . : . : . :
rJMSF009A12+ GGTTGGATTGCTTGAATCTATAGTTTTCAGTACTTGTTTGCTAGTC-TAAGTAAAACTAG
rJMFF011G05+ GGTTGGATTGCTTGAATCTATAGTTTTCAGTACTTGTTTGCTAGTCATAAGTAAAACTAG
rJMFF011K05+ GGTTGGATTGCTTGAATCTATAGTTTTCAGTACTTGTTTGCTAGTC-TAAGTAAAACTAG
                      ____________________________________________________________
consensus GGTTGGATTGCTTGAATCTATAGTTTTCAGTACTTGTTTGCTAGTC-TAAGTAAAACTAG
 
. : . : . : . : . : . :
rJMSF009A12+ TTTCATCGAGGAAAAGTTTTCGTTTTGCTGCTCTTTATAATATTTGCAGGATTAGTTTCA
rJMFF011G05+ TTTCATCGAGGAAAAGTTNTCGTTNTGCTGCTCNTTATAATATTTGCAGGATNAGTNTCA
rJMFF011K05+ TTTCATCGAGGAAAAGTTTTCGTTTTGCTGCTCTTTATAATATTTGCAGGATTAGTTTCA
                      ____________________________________________________________
consensus TTTCATCGAGGAAAAGTTTTCGTTTTGCTGCTCTTTATAATATTTGCAGGATTAGTTTCA
 
. : . : . : . : . : . :
rJMSF009A12+ CTTTATTGTGCTTATAGCTATTTTACTAGATGAGCTTGTTGCAT
rJMFF011G05+ CTTTATTGTGCTTATAGCTATNTTACTAGATGAGCTTGTTGCATTGTTTCTCATTGTCTG
rJMFF011K05+ CTTTATTGTGCTTATAGCTATTTTACTAGATGAGCTTGTTGCATTGTTTCTCATTGTCTG
                      ____________________________________________________________
consensus CTTTATTGTGCTTATAGCTATTTTACTAGATGAGCTTGTTGCATTGTTTCTCATTGTCTG
 
. : . : . : . : . : . :
rJMFF011G05+ CGAGATATATGAGTCTACTCTANGTCGAACCTCTATCTGC
rJMFF011K05+ CGAGATATATGAGTCTACTTTATGTCGAACTTCTATCTGCTTGATTCTGATGAGTCTTTT
                      ____________________________________________________________
consensus CGAGATATATGAGTCTACTTTATGTCGAACTTCTATCTGCTTGATTCTGATGAGTCTTTT