Previous Contig 008721:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011J24Sequence548014276gb:AP004058_18370411e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13706008721 (3)
JMFF024G03Sequence490014568gb:AP004058_18370411e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13761008721 (3)pir|T01837|T018377e-09hypothetical protein T15F16.1 - Arabidopsis thaliana>gb:T15F16_1723495 Arabidops
JMFN044I08Sequence557008721 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024G03+ AGGCCACGTGAAATCAATCCCCTGGTTGAACAGAAATGGATGCAGCTTGAACGGGAACT
                      ____________________________________________________________
consensus AGGCCACGTGAAATCAATCCCCTGGTTGAACAGAAATGGATGCAGCTTGAACGGGAACT
 
. : . : . : . : . : . :
rJMFF024G03+ AGAGAGGAATGATGTCATCAGTGCAGTAACATCAGCAGTGCCCGGGGCTGTTGTTTTTGG
                      ____________________________________________________________
consensus AGAGAGGAATGATGTCATCAGTGCAGTAACATCAGCAGTGCCCGGGGCTGTTGTTTTTGG
 
. : . : . : . : . : . :
rJMFF024G03+ TGATTATGTAATTGGAGAGCACTACGGTTCTGAATCAGAGGATGAGGATGAGGATGGATT
rJMFF011J24+ GAGAGCACTACGGTTCTGAATCAGAGGATGAGGATGAGGATGGATT
                      ____________________________________________________________
consensus TGATTATGTAATTGGAGAGCACTACGGTTCTGAATCAGAGGATGAGGATGAGGATGGATT
 
. : . : . : . : . : . :
rJMFF024G03+ TGATGCAGAAGTGGAGCAGAATGAAGATTTCAGAATGAGAGCCGATAGCAGTTGGATGAG
JMFN044I08- GCAGAATGAAGATTTCAGAATGAGAGCCGATAGCAGTTGGATGAG
rJMFF011J24+ TGATGCAGAAGTGGAGCAGAATGAAGATTTCAGAATGAGAGCCGATAGCAGTTGGATGAG
                      ____________________________________________________________
consensus TGATGCAGAAGTGGAGCAGAATGAAGATTTCAGAATGAGAGCCGATAGCAGTTGGATGAG
 
. : . : . : . : . : . :
rJMFF024G03+ CTTTCTACTTTTTCTGCAGGCCTTTGGTTCAGCACATGGTAGTCGTTCAGATAGAGATAC
JMFN044I08- CTTTCTACTTTTTCTGCAGGCCTTTGGTTCAGCACATGGTAGTCGTTCAGATAGAGATAC
rJMFF011J24+ CTTTCTACTTTTTCTGCAGGCCTTTGGTTCAGCACATGGTAGTCGTTCAGATAGAGATAC
                      ____________________________________________________________
consensus CTTTCTACTTTTTCTGCAGGCCTTTGGTTCAGCACATGGTAGTCGTTCAGATAGAGATAC
 
. : . : . : . : . : . :
rJMFF024G03+ GAGGCATCAGGGTATAGATTCAAATCATGGACTGGGTGAAGGCACTGTTAGAATTAACAA
JMFN044I08- GAGGCATCAGGGTATAGATTCAAATCATGGACTGGGTGAAGGCACTGTTAGAATTAACAA
rJMFF011J24+ GAGGCATCAGGGTATAGATTCAAATCATGGACTGGGTGAAGGCACTGTTAGAATTAACAA
                      ____________________________________________________________
consensus GAGGCATCAGGGTATAGATTCAAATCATGGACTGGGTGAAGGCACTGTTAGAATTAACAA
 
. : . : . : . : . : . :
rJMFF024G03+ CCCACCTCTTAGAATTAACAACCCCCCTCTTAGAATCAACAACCCCCCTCTTAGAATCAA
JMFN044I08- CCCACCTCTTAGAATTAACAACCCCCCTCTTAGAATCAACAACCCCCCTCTTAGAATCAA
rJMFF011J24+ CCCACCTCTTAGAATTAACAACCCCCCTCTTAGAATCAACAACCCCCCTCTTAGAATCAA
                      ____________________________________________________________
consensus CCCACCTCTTAGAATTAACAACCCCCCTCTTAGAATCAACAACCCCCCTCTTAGAATCAA
 
. : . : . : . : . : . :
rJMFF024G03+ CAACCCCCCTCAGATTGGTACTTTTGGTTTCCCAGATGAAGATAGTGGTGGTATTGCTGA
JMFN044I08- CAACCCCCCTCAGATTGGTACTTTTGGTTTCCCAGATGAAGATAGTGGTGGTATTGCTGA
rJMFF011J24+ CAACCCCCCTCAGATTGGTACTTTTGGTTTCCCAGATGAAGATAGTGGTGGTATTGCTGA
                      ____________________________________________________________
consensus CAACCCCCCTCAGATTGGTACTTTTGGTTTCCCAGATGAAGATAGTGGTGGTATTGCTGA
 
. : . : . : . : . : . :
rJMFF024G03+ AGATGTTCAAGATAATCATACAACCATACAACACTAATTCTGCATCTCACCAAGATAGAG
JMFN044I08- AGATGTTCAAGATAATCATACAACCATACAACACTAATTCTGCATCTCACCAAGATAGAG
rJMFF011J24+ AGATGTTCAAGATAATCATACAACCATACAACACTAATTCTGCATCTCACCAAGATAGAG
                      ____________________________________________________________
consensus AGATGTTCAAGATAATCATACAACCATACAACACTAATTCTGCATCTCACCAAGATAGAG
 
. : . : . : . : . : . :
rJMFF024G03+ TCCTTTTGCAGCGCTCTGGGAGAAGGTGGCAGAGCCAAGCCAATGGAGGTCAATAATAGA
JMFN044I08- TCCTTTTGCAGCGCTCTGGGAGAAGGTGGCAGAGCCAAGCCAATGGAGGTCAATAATAGA
rJMFF011J24+ TCCTTTTGCAGCGCTCTGGGAGAAGGTGGCAGAGCCAAGCCAATGGAGGTCAATAATAGA
                      ____________________________________________________________
consensus TCCTTTTGCAGCGCTCTGGGAGAAGGTGGCAGAGCCAAGCCAATGGAGGTCAATAATAGA
 
. : . : . : . : . : . :
rJMFF024G03+ TGTTGTCAATTGAAGTTTCAAAATGGTAAGGAAAATATGAAATTTTAGGCTCACTTTTAG
JMFN044I08- TGTTGTCAATTGAAGTTTCAAAATGGTAAGGAAAATATGAAATTTTAGGCTCACTTTTAG
rJMFF011J24+ TGTTGTCAATTGAAGTTTCAAAATGGTAAGGAAAATATGAAATTTTAGGCTCACTTTTAG
                      ____________________________________________________________
consensus TGTTGTCAATTGAAGTTTCAAAATGGTAAGGAAAATATGAAATTTTAGGCTCACTTTTAG
 
. : . : . : . : . : . :
rJMFF024G03+ TCTTTTAAAATGTACTAATGTACTCCATAACTTTTTAACTATACTCTGACATGGCCTTCT
JMFN044I08- TCTTTTAAAATGTACTAATGTACTCCATAACTTTTTAACTATACTCTGACATGGCCTTCT
rJMFF011J24+ TCTTTTAAAATGTACTAATGTACTCCATAACTTTTTAACTATACTCTGACATGGCCTTCT
                      ____________________________________________________________
consensus TCTTTTAAAATGTACTAATGTACTCCATAACTTTTTAACTATACTCTGACATGGCCTTCT
 
. : . : . : . : . : . :
rJMFF024G03+ TCTCACTGATGCTCAAAAGTTGAAGTTGATGTATTGTTTGGT
JMFN044I08- TCTCACTGATGCTCAAAAGTTGAAGTTGATGT
rJMFF011J24+ TCTCACTGATGCTCAAAAGTTGAAGTTGATGTATTGTTTGGTGATTCTGTGAACATTTTA
                      ____________________________________________________________
consensus TCTCACTGATGCTCAAAAGTTGAAGTTGATGTATTGTTTGGTGATTCTGTGAACATTTTA
 
. : . : . : . : . : . :
rJMFF011J24+ CTTGTCAATAACTGAAATTGATGTAGTTTTTCTTGTAATTTCATTAATTTTTTAATCAAA
                      ____________________________________________________________
consensus CTTGTCAATAACTGAAATTGATGTAGTTTTTCTTGTAATTTCATTAATTTTTTAATCAAA