Previous Contig 008720:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B11Sequence581000125 (8)gb:AF255679_17812078e-82Arabidopsis thaliana eIF3e mRNA, complete cds.748008720 (9)gb:AY039913_15604263e-89Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMFF011J13Sequence544000125 (8)gb:AF255679_17812073e-75Arabidopsis thaliana eIF3e mRNA, complete cds.734008720 (9)gb:AY039913_15604268e-76Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMFF016G24Sequence300000125 (8)gb:AF255679_17812072e-42Arabidopsis thaliana eIF3e mRNA, complete cds.705008720 (9)gb:AY039913_15604266e-72Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMFF034L22Sequence536000125 (8)gb:AF255679_17812076e-74Arabidopsis thaliana eIF3e mRNA, complete cds.733008720 (9)gb:AY039913_15604268e-89Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMFN012G07Sequence528008720 (9)gb:AY039913_15604265e-53Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMSF030O21Sequence645000125 (8)gb:AF255679_17812073e-97Arabidopsis thaliana eIF3e mRNA, complete cds.698008720 (9)gb:AY039913_15604262e-84Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMSF033G15Sequence670000125 (8)gb:AF255679_17812071e-96Arabidopsis thaliana eIF3e mRNA, complete cds.770008720 (9)gb:AY039913_1560426e-101Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMSF035A06Sequence649000125 (8)gb:AF255679_17812071e-97Arabidopsis thaliana eIF3e mRNA, complete cds.758008720 (9)gb:AY039913_15604264e-91Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,
JMSF048E01Sequence707000125 (8)gb:AF255679_1781207e-106Arabidopsis thaliana eIF3e mRNA, complete cds.711008720 (9)gb:AY039913_15604262e-90Arabidopsis thaliana putative translation initiation factor 3 (At3g57290) mRNA,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035A06+ GAAGGACCCAGATCNNTGACCTGTTAACCAGGACAAGTACNTAAATGCCATTCAA
rJMSF033G15+ TGACCTGTTAACCAGGACAAGTACTTAAATGCCANTCAA
                      ____________________________________________________________
consensus GAAGGACCCAGATCNNTGACCTGTTAACCAGGACAAGTACTTAAATGCCATTCAA
 
. : . : . : . : . : . :
rJMSF035A06+ ACAAATGCTCCTCATCTACTGCG-TATCTGGCAACTGCATTCATTGTCAACAAAAGAAGA
rJMSF033G15+ ACAAATGCTCCTCATCTACTGCGTTATCTGGCAACTGCATTCATTGTCAACAAAAGAAGA
rJMSF048E01+ CTGGCAACTGCATTCATTGTCAACAAAAGAAGA
rJMSF030O21+ GA
rJMFF034L22+ GCAACTGCATTCATTGTCAACAAAAGAAGA
rJMFF003B11+ CTGGCAACTGCATTCATTGTCAACAAAAGAAGA
rJMFF011J13+ TTGTCAACAAAAGAAGA
                      ____________________________________________________________
consensus ACAAATGCTCCTCATCTACTGCGTTATCTGGCAACTGCATTCATTGTCAACAAAAGAAGA
 
. : . : . : . : . : . :
rJMSF035A06+ CGACCTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMSF033G15+ CGACCTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMSF048E01+ CGACCTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMSF030O21+ CGACCTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMFF034L22+ CGACNTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMFF016G24+ TTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMFF003B11+ CGACNTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
rJMFF011J13+ CGACCTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTNTTATGCAGAC
                      ____________________________________________________________
consensus CGACCTCAGTTTAAAGATTTTATAAAGGTTATTCAGCCAGAGCAGTACTCTTATGCAGA-
 
. : . : . : . : . : . :
rJMSF035A06+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMSF033G15+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMSF048E01+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMSF030O21+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMFF034L22+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMFF016G24+ CCCCATCANTGAGTTTTTGNCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMFF003B11+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
rJMFF011J13+ CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
                      ____________________________________________________________
consensus CCCCATCACTGAGTTTTTGGCCTGTGTTTATGTCAATTATGACTTCGATGCAGCACAGCA
 
. : . : . : . : . : . :
rJMSF035A06+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
rJMSF033G15+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
rJMSF048E01+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
rJMSF030O21+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
rJMFF034L22+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
rJMFF016G24+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
JMFN012G07+ TGA
rJMFF003B11+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
rJMFF011J13+ AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
                      ____________________________________________________________
consensus AAAGATGAAAGAGTGTGAAGAGGTAATTTTGAATGATCCATTCTTGGGCAAAAGAGTTGA
 
. : . : . : . : . : . :
rJMSF035A06+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMSF033G15+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMSF048E01+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMSF030O21+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMFF034L22+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMFF016G24+ AGAGGGCAATTTTTCAACTGTGCCATNGAGGGATGAATTCNTAGAAAATGCTCGCCTTTT
JMFN012G07+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMFF003B11+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
rJMFF011J13+ AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
                      ____________________________________________________________
consensus AGAGGGCAATTTTTCAACTGTGCCATTGAGGGATGAATTCCTAGAAAATGCTCGCCTTTT
 
. : . : . : . : . : . :
rJMSF035A06+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMSF033G15+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMSF048E01+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMSF030O21+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMFF034L22+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMFF016G24+ TATCTTTGAGACNTNNTGCCGCATTCATCAGCGCACTTGATANGGGGGTTCTTNNNGAGA
JMFN012G07+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMFF003B11+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
rJMFF011J13+ TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
                      ____________________________________________________________
consensus TATCTTTGAGACCTACTGCCGCATTCATCAGCGCA-TTGATATGGGGGTTCTTGCTGAGA
 
. : . : . : . : . : . :
rJMSF035A06+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMSF033G15+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMSF048E01+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMSF030O21+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMFF034L22+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMFF016G24+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
JMFN012G07+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMFF003B11+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
rJMFF011J13+ AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
                      ____________________________________________________________
consensus AACTAAATTTGAATTATGAGGATGCGGAGAGATGGATTGTGAATCTTATCAGGACTTCCA
 
. : . : . : . : . : . :
rJMSF035A06+ AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMSF033G15+ AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMSF048E01+ AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMSF030O21+ AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMFF034L22+ AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMFF016G24+ AGCTTGATGCTAAGATAGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
JMFN012G07+ AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMFF003B11+ AGCTTGATGCTAAGATAGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
rJMFF011J13+ AGCTTGATGCTAAGATAGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
                      ____________________________________________________________
consensus AGCTTGATGCTAAGATTGATTCCGAAACAGGAACTGTTATAATGGAACCTACTCATCCCA
 
. : . : . : . : . : . :
rJMSF035A06+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMSF033G15+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMSF048E01+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMSF030O21+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMFF034L22+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMFF016G24+ ATGTTTATGAGCAGNTAATTGATCATACAAAAGGTCTTTCTGGNCGTACATACAAGTTGG
JMFN012G07+ ATGTTTATGAGCAGCTAATTGATCATATAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMFF003B11+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
rJMFF011J13+ ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
                      ____________________________________________________________
consensus ATGTTTATGAGCAGCTAATTGATCATACAAAAGGTCTTTCTGGACGTACATACAAGTTGG
 
. : . : . : . : . : . :
rJMSF035A06+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMSF033G15+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMSF048E01+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMSF030O21+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMFF034L22+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMFF016G24+ NGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCNTACCAGATAGTTTTGGTATT
JMFN012G07+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMFF003B11+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
rJMFF011J13+ TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
                      ____________________________________________________________
consensus TGAGTCAGCTTCTTGAGCATGCCCAGTCACAAGCACAGCCTACCAGATAGTTTTGGTATT
 
. : . : . : . : . : . :
rJMSF035A06+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMSF033G15+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMSF048E01+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMSF030O21+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMFF034L22+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMFF016G24+ GAAGCCAAAGGATTTTNTGGTAGTCAATACTTTTNGAAGAGTTTTGTTTTGGTNTAGTTA
JMFN012G07+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMFF003B11+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
rJMFF011J13+ GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
                      ____________________________________________________________
consensus GAAGCCAAAGGATTTTTTGGTAGTCAATACTTTTCGAAGAGTTTTGTTTTGGTTTAGTTA
 
. : . : . : . : . : . :
rJMSF035A06+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACT
rJMSF033G15+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
rJMSF048E01+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
rJMSF030O21+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
rJMFF034L22+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
rJMFF016G24+ CTTATTTNAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
JMFN012G07+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
rJMFF003B11+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
rJMFF011J13+ CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
                      ____________________________________________________________
consensus CTTATTTTAATGCTTTGTATTGTGTTAGTTTTATGGAATTCCAACTTTTTAAGATTGATG
 
. : . : . : . : . : . :
rJMSF033G15+ GATTT
rJMSF048E01+ GATTTTATCCATGGTACTA
rJMSF030O21+ GATTTTAT-CATGGTACTATTTATCATTCAGTAATC
rJMFF034L22+ GATTTTAT-CATGGTACTATTTATCATTCAGTAATCTGTAGTG-CAG
rJMFF016G24+ GATTCTAT-CATGGTACTATTTATCATTCAGTAATCTGTAGTG-CAGTGTTCATAAA
JMFN012G07+ GATTTTAT-CATGGTACTATTTATCATTCAGTAATCTGTAGTG-CAG
rJMFF003B11+ GATTTTAT-CATGGTACTATTTATCATTCAGTAATCTGTAGTGCCAGTGTTCATAAA
rJMFF011J13+ GATTTTAT-CATGGTACTATTTATCATTCAGTAATCTGTAGTG-CAGTGTTCATAAATGG
                      ____________________________________________________________
consensus GATTTTAT-CATGGTACTATTTATCATTCAGTAATCTGTAGTG-CAGTGTTCATAAATGG