Previous Contig 008717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011I16Sequence588008717 (2)gb:AF492634_18049594e-43Capsicum annuum upa10 mRNA, complete cds.710008717 (2)gb:AF492634_18049593e-41Capsicum annuum upa10 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011I16- ACCAAGCAATGGAATCTCATCTTAATTCCAAAACATTATTTCTTGTGCTTTTCTTCTTAA
                      ____________________________________________________________
consensus ACCAAGCAATGGAATCTCATCTTAATTCCAAAACATTATTTCTTGTGCTTTTCTTCTTAA
 
. : . : . : . : . : . :
JMFF011I16- CCTTTGCACAAACTTGCTATGGAGCAGTTCTCTTCTCTTCCCTTCCACAAACTCTGCTTG
                      ____________________________________________________________
consensus CCTTTGCACAAACTTGCTATGGAGCAGTTCTCTTCTCTTCCCTTCCACAAACTCTGCTTG
 
. : . : . : . : . : . :
JMFF011I16- TCTCTGCTTCTCCTAAAGAAGGCCAAGTTGTAAAAGCTGGAGAAGACAGCATAAGTATGA
rJMFF011I16+ TCCTAAAGAAGGCCAAGTTGTAAAAGCTGGAGAAGACAGCATAAGTATGA
                      ____________________________________________________________
consensus TCTCTGCTTCTCCTAAAGAAGGCCAAGTTGTAAAAGCTGGAGAAGACAGCATAAGTATGA
 
. : . : . : . : . : . :
JMFF011I16- GCTGGGGACTGAACCAGAGCTATGAAAGAGGGGTAGATGAGTCATATAAGACCACAAAGG
rJMFF011I16+ GCTGGGGACTGAACCAGAGCTATGAAAGAGGGGTAGATGAGTCATATAAGACCACAAAGG
                      ____________________________________________________________
consensus GCTGGGGACTGAACCAGAGCTATGAAAGAGGGGTAGATGAGTCATATAAGACCACAAAGG
 
. : . : . : . : . : . :
JMFF011I16- TGAAACTATGCTATGCCCCAGAAAGCCAGGCAGACCGAGGATGGAGGAAAACTGTGGATG
rJMFF011I16+ TGAAACTATGCTATGCCCCAGAAAGCCAGGCAGACCGAGGATGGAGGAAAACTGTGGATG
                      ____________________________________________________________
consensus TGAAACTATGCTATGCCCCAGAAAGCCAGGCAGACCGAGGATGGAGGAAAACTGTGGATG
 
. : . : . : . : . : . :
JMFF011I16- ACCTTAGCAAGGACAAAACATGCCAATTTAGCATAGTTGAAAGGCCTTACTACAGTAGTG
rJMFF011I16+ ACCTTAGCAAGGACAAAACATGCCAATTTAGCATAGTTGAAAGGCCTTACTACAGTAGTG
                      ____________________________________________________________
consensus ACCTTAGCAAGGACAAAACATGCCAATTTAGCATAGTTGAAAGGCCTTACTACAGTAGTG
 
. : . : . : . : . : . :
JMFF011I16- AAAAAAACCAAAGTTTTGAATGGATGATAGAGACTGATGTTCCCACAGCCTTGTATTTCG
rJMFF011I16+ AAAAAAACCAAAGTTTTGAATGGATGATAGAGACTGATGTTCCCACAGCCTTGTATTTCG
                      ____________________________________________________________
consensus AAAAAAACCAAAGTTTTGAATGGATGATAGAGACTGATGTTCCCACAGCCTTGTATTTCG
 
. : . : . : . : . : . :
JMFF011I16- TTAGAGCTTATGCATATGATTCGGCTGGTAATGAGGTGGCTTATGGTCACACCATTGCTC
rJMFF011I16+ TTAGAGCTTATGCATATGATTCGGCTGGTAATGAGGTGGCTTATGGTCACACCATTGCTC
                      ____________________________________________________________
consensus TTAGAGCTTATGCATATGATTCGGCTGGTAATGAGGTGGCTTATGGTCACACCATTGCTC
 
. : . : . : . : . : . :
JMFF011I16- TCTTCAAGGTTCAAGCAACCAGTGGCCGCCATTTGTCTCTTGACATTGCTGCGGCTTGCT
rJMFF011I16+ TCTTCAAGGTTCAAGCAACCAGTGGCCGCCATTTGTCTCTTGACATTGCTGCGGCTTGCT
                      ____________________________________________________________
consensus TCTTCAAGGTTCAAGCAACCAGTGGCCGCCATTTGTCTCTTGACATTGCTGCGGCTTGCT
 
. : . : . : . : . : . :
JMFF011I16- TCTCTGGCTTCGCTTTGGTGTCTGTCTTTGGGTTCTTCTTTGCAGAAA
rJMFF011I16+ TCTCTGGCTTCGCTTTGGTGTCTGTCTTTGGGTTCTTCTTTGCAGAAAAAAGGGGTAGAA
                      ____________________________________________________________
consensus TCTCTGGCTTCGCTTTGGTGTCTGTCTTTGGGTTCTTCTTTGCAGAAAAAAGGGGTAGAA
 
. : . : . : . : . : . :
rJMFF011I16+ GGCTTATGGCTGCAAACAATTGATGAGAGGATAACGCAACTCTCCTCACTGATTAGAAAG
                      ____________________________________________________________
consensus GGCTTATGGCTGCAAACAATTGATGAGAGGATAACGCAACTCTCCTCACTGATTAGAAAG
 
. : . : . : . : . : . :
rJMFF011I16+ GAGAAATTGTGGAGAAAATTTTAATAATAAGGTCAAAGTTCAAATATTGTTTACAAAGAA
                      ____________________________________________________________
consensus GAGAAATTGTGGAGAAAATTTTAATAATAAGGTCAAAGTTCAAATATTGTTTACAAAGAA
 
. : . : . : . : . : . :
rJMFF011I16+ TAGAATTGTTCCCCGTATGAGGGGTTCCATTGGAGATAGTATAAACTATATAGTAGTTTG
                      ____________________________________________________________
consensus TAGAATTGTTCCCCGTATGAGGGGTTCCATTGGAGATAGTATAAACTATATAGTAGTTTG
 
. : . : . : . : . : . :
rJMFF011I16+ GGGGTGTCTCCTCCGCTCTAGATGTAAAAAAAATAAAAAATAAAAAATAAAAAATTAGAA
                      ____________________________________________________________
consensus GGGGTGTCTCCTCCGCTCTAGATGTAAAAAAAATAAAAAATAAAAAATAAAAAATTAGAA