Previous Contig 008715:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011H24Sequence541014273gb:AC134886_17418508e-11Oryza sativa chromosome 3 BAC OSJNBa0002D18 genomic sequence, complete sequence.673008715 (3)gb:AY742298_11799235e-66Malus x domestica protein disulfide isomerase mRNA, partial cds.
JMSF045A15Sequence734008715 (3)gb:QSU316614_17032453e-47Quercus suber mRNA for PDI-like protein (pdiqs gene).258008715 (3)gb:AY742298_11799231e-26Malus x domestica protein disulfide isomerase mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045A15- GGTCTCTGTTGGCTCCACATTCTTATTGTCTCTTCTTGCC
                      ____________________________________________________________
consensus GGTCTCTGTTGGCTCCACATTCTTATTGTCTCTTCTTGCC
 
. : . : . : . : . : . :
JMSF045A15- ACCAAAGATCGTGACTTTCTCCTCTCCCCTTCTGGAACTCAGGTGAAAATTTCTGAGCTT
                      ____________________________________________________________
consensus ACCAAAGATCGTGACTTTCTCCTCTCCCCTTCTGGAACTCAGGTGAAAATTTCTGAGCTT
 
. : . : . : . : . : . :
JMSF045A15- CGAACCAAAGTTATTGGTATATACTTTTCGGCTAACTGACTCGGAGGCGTTTGCTGCTTA
                      ____________________________________________________________
consensus CGAACCAAAGTTATTGGTATATACTTTTCGGCTAACTGACTCGGAGGCGTTTGCTGCTTA
 
. : . : . : . : . : . :
JMSF045A15- CCGGGCATCCATGCCTTGGCTTGCAATTCCATTTTCAGACCTGGAAACCAAGAAATCCTT
                      ____________________________________________________________
consensus CCGGGCATCCATGCCTTGGCTTGCAATTCCATTTTCAGACCTGGAAACCAAGAAATCCTT
 
. : . : . : . : . : . :
JMSF045A15- GAACCAGAGGTTCAATGTTGAGGGCATTCCTTGCCTGGTTGTTCTGCAGCCTAACAATAA
                      ____________________________________________________________
consensus GAACCAGAGGTTCAATGTTGAGGGCATTCCTTGCCTGGTTGTTCTGCAGCCTAACAATAA
 
. : . : . : . : . : . :
JMSF045A15- CAAAGATGATGCAATAGTTTATGATGGGGTTGAACTTGTTTATCGGTATGGGGTGGAAGC
                      ____________________________________________________________
consensus CAAAGATGATGCAATAGTTTATGATGGGGTTGAACTTGTTTATCGGTATGGGGTGGAAGC
 
. : . : . : . : . : . :
JMSF045A15- TTTTCCGTTTACGAAAGAGAGGTTGCAGAAGTTGCGAGAGGACGAGAGGGAGAAACACGA
                      ____________________________________________________________
consensus TTTTCCGTTTACGAAAGAGAGGTTGCAGAAGTTGCGAGAGGACGAGAGGGAGAAACACGA
 
. : . : . : . : . : . :
JMSF045A15- AAAGCAGACTTTGAAAGACTTGTTAACGAACAGCAATAGAGATTTTGTTTTAGGCCACTC
                      ____________________________________________________________
consensus AAAGCAGACTTTGAAAGACTTGTTAACGAACAGCAATAGAGATTTTGTTTTAGGCCACTC
 
. : . : . : . : . : . :
JMSF045A15- CACAATGGGAAAGGTGCCTGTCACTTCGTTAACTGGTAAAACAATCGGGCTGTATTTCTC
                      ____________________________________________________________
consensus CACAATGGGAAAGGTGCCTGTCACTTCGTTAACTGGTAAAACAATCGGGCTGTATTTCTC
 
. : . : . : . : . : . :
JMSF045A15- AGCCAAATGGTGTGTCCCGGGGTTGAAGTTTACTTCCAAGCTAATCTCGGTTTACCAAAA
rJMFF011H24+ CGGTTTACCAAAA
                      ____________________________________________________________
consensus AGCCAAATGGTGTGTCCCGGGGTTGAAGTTTACTTCCAAGCTAATCTCGGTTTACCAAAA
 
. : . : . : . : . : . :
JMSF045A15- GATTAAGCAGAGGCTACCCGAGGGTGAGGATTTTGAAATAGTTTATGTGTCGAGCGACGA
rJMFF011H24+ GATTAAGCAGAGGCTACCCGAGGGTGAGGATTTTGAAATAGTTTATGTGTCGAGCGACGA
                      ____________________________________________________________
consensus GATTAAGCAGAGGCTACCCGAGGGTGAGGATTTTGAAATAGTTTATGTGTCGAGCGACGA
 
. : . : . : . : . : . :
JMSF045A15- TGGGGAAATGGAATTCGAAGGCTATTTCGAGGCGATGCCATGGTTGGCACTCCCTTTTGG
rJMSF045A15+ CATGGTTGGCANTCCCTTTCGG
rJMFF011H24+ TGGGGAAATGGAATTCGAAGGCTATTTCGAGGCGATGCCATGGTTGGCACTCCCTTTTGG
                      ____________________________________________________________
consensus TGGGGAAATGGAATTCGAAGGCTATTTCGAGGCGATGCCATGGTTGGCACTCCCTTTTGG
 
. : . : . : . : . : . :
JMSF045A15- TGATCCAAATGCCAAGAACCTAANAAAGTATTTC
rJMSF045A15+ TGATCCAAATGCCAAGAACCTANGAAAGTATTTNGACATTNGAGGGNTTCCCAGCTTGGT
rJMFF011H24+ TGATCCAAATGCCAAGAACCTAAGAAAGTATTTCGACATTAGAGGGATTCCCAGCTTGGT
                      ____________________________________________________________
consensus TGATCCAAATGCCAAGAACCTAAGAAAGTATTTCGACATTAGAGGGATTCCCAGCTTGGT
 
. : . : . : . : . : . :
rJMSF045A15+ AATCTTGGGGCCTGATGGCAAAACTNTGAGCAAACAAGGGAGGANCCTTGTATGCCTGTA
rJMFF011H24+ AATCTTGGGGCCTGATGGCAAAACTCTGAGCAAACAAGGGAGGAACCTTGTATGCCTGTA
                      ____________________________________________________________
consensus AATCTTGGGGCCTGATGGCAAAACTCTGAGCAAACAAGGGAGGAACCTTGTATGCCTGTA
 
. : . : . : . : . : . :
rJMSF045A15+ TAAAGAAAATGCATATCCCTTCACAAAGGCGAGAATGGAGGCGCTGGAGAGGGAGATGGA
rJMFF011H24+ TAAAGAAAATGCATATCCCTTCACAAAGGCGAGAATGGAGGCGCTGGAGAGGGAGATGGA
                      ____________________________________________________________
consensus TAAAGAAAATGCATATCCCTTCACAAAGGCGAGAATGGAGGCGCTGGAGAGGGAGATGGA
 
. : . : . : . : . : . :
rJMSF045A15+ CGAAGAGGCGAAATGGCTTCCAAAATCGAAGCACCNCGGGGNGCNTAAGCATGAG
rJMFF011H24+ CGAAGAGGCGAAATGGCTTCCAAAATCGAAGCACCACGGGGGGCATAAGCATGAGCTAAG
                      ____________________________________________________________
consensus CGAAGAGGCGAAATGGCTTCCAAAATCGAAGCACCACGGGGGGCATAAGCATGAGCTAAG
 
. : . : . : . : . : . :
rJMFF011H24+ TCTGGTCTCGGAAGGGACTGGGGGTGGAGCTTACATATGTTGTGAGTGCGACGAGCAGGG
                      ____________________________________________________________
consensus TCTGGTCTCGGAAGGGACTGGGGGTGGAGCTTACATATGTTGTGAGTGCGACGAGCAGGG
 
. : . : . : . : . : . :
rJMFF011H24+ GCATGGGTGGGCTTACCAGTGCCTCGAGTGCGGGTATGAAGTGCACCCCAATTGCGTGAG
                      ____________________________________________________________
consensus GCATGGGTGGGCTTACCAGTGCCTCGAGTGCGGGTATGAAGTGCACCCCAATTGCGTGAG
 
. : . : . : . : . : . :
rJMFF011H24+ GACTATCGACCATGGTCAGACCTCCTAGAGGTAATCAAACTAAACCAACTTACTGGACTG
                      ____________________________________________________________
consensus GACTATCGACCATGGTCAGACCTCCTAGAGGTAATCAAACTAAACCAACTTACTGGACTG
 
. : . : . : . : . : . :
rJMFF011H24+ GTTTGTTGTTTGTGTAATTGGGAAGATTAAGACACATTCCCTTCATGCAGCCATGGGGTT
                      ____________________________________________________________
consensus GTTTGTTGTTTGTGTAATTGGGAAGATTAAGACACATTCCCTTCATGCAGCCATGGGGTT
 
. : . : . : . : . : . :
rJMFF011H24+ TTCAGCTTTGTTGTATTAGTACTATGTATTGTCTATGGTTAAGTTTTAATTTGTTACTCG
                      ____________________________________________________________
consensus TTCAGCTTTGTTGTATTAGTACTATGTATTGTCTATGGTTAAGTTTTAATTTGTTACTCG